We narrowed to 5,296 results for: mag
-
Plasmid#172127PurposeExpression of EBFP and tTA-InteinN in Flp recombinase positive cellsDepositorInsertEBFP, tTAn-InteinN
UseAAVPromoterEF1aAvailable sinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAS1_4xh7SKPylT_EF1_GFP*_Intein_DD
Plasmid#162812PurposeSTELLA plasmid for amber suppression of C-terminally labelled GFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGFP(C-TAG)-Intein-DD
UsePiggybacExpressionMammalianMutationGFP(Opal247,Amber)PromoterEF1alphaAvailable sinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
FN(9-10)-I27-CC
Plasmid#85394PurposeMTFM mechanosensor for integrin. Fibronectin domains 9&10 fused to titan immunoglobulin domain (I27) with two cysteines for immobilization, site for p-azidophenylalanine incorporation & Cy3 labelingDepositorInsertFibronectin (FN) domains 9 & 10 for integrin binding fused to titin immunoglobulin domain (I27), containing a TAG (amber) codon
Tags6x HisExpressionBacterialPromoterT7Available sinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYNL-N1_zyxin
Plasmid#65681PurposeExpresses Zyxin-YNL in mammalian cellsDepositorAvailable sinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCNL-C1_H2B
Plasmid#65703PurposeExpresses CNL-H2B in mammalian cellsDepositorInserthistone H2B
UseLuciferaseTagsCNLExpressionMammalianPromoterCMVAvailable sinceJune 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYNL-N1_3xNLS
Plasmid#65672PurposeExpresses NLS-YNL in mammalian cellsDepositorInsertthree copies of SV40 nuclear localization signal
UseLuciferaseExpressionMammalianPromoterCMVAvailable sinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
MXS_PGK::tTA2-bGHpA
Plasmid#62448PurposeMXS_chaining vector with PGK::tTA2-bGHpADepositorInsertcassette containing the tetracycline transactivator with PGK promoter
UseSynthetic BiologyAvailable sinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
Nano-lantern-peroxisome/pcDNA3
Plasmid#51974Purposemammalian expression of Nano-lantern, a luminescent protein for high-speed single-cell and whole body imaging, targeted to peroxisomesDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNano-lantern
TagsSKLExpressionMammalianMutationS257G in Rluc8Available sinceMarch 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-MPP4
Plasmid#23417DepositorInsertMPP4 (MPP4 Human)
UseGateway CloningAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf90
Plasmid#12778PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf90
ExpressionMammalianAvailable sinceDec. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
pHR-CD5-NbHA-mCherry
Plasmid#242817PurposeStable expression of NbHA-mCherry for secretion of fusion protein into the extracellular mediumDepositorPublicationInsertNbHA
UseLentiviralTagsmCherryExpressionMammalianPromoterSFFVAvailable sinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHR-CD5-NbHA-sfGFP
Plasmid#242818PurposeStable expression of NbHA-superfolderGFP for secretion of fusion protein into the extracellular mediumDepositorPublicationInsertNbHA
UseLentiviralTagssfGFPExpressionMammalianPromoterSFFVAvailable sinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-NES-SomaFRCaMPi
Plasmid#232836PurposeAAV transfer plasmid for CAG-mediated Cre-dependent expression of soma-targeted FRCaMPiDepositorInsertNES-FRCaMPi
UseAAVTagsnuclear export sequenceExpressionMammalianPromoterCAGAvailable sinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-HaloEKAR2.2-T2A-EGFP
Plasmid#216495PurposeExpression of chemigenetic ERK biosensor (low basal brightness, extremly high dynamic range) and EGFP transfection marker in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHaloEKAR2.2
TagsT2A-EGFPExpressionMammalianPromoterCMVAvailable sinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-SspB-PPM1H
Plasmid#232870PurposeExpresses SspB-PPM1H in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHalo-SspB-PPM1H (PPM1H )
TagsHalo-SspBExpressionMammalianAvailable sinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME Actin Vhh Halo Tag (JDW 1223)
Plasmid#224498PurposeGateway compatible middle entry clone containing an Actin nanonbody fused to a flexible linker and Halo Tag (For visualizing actin, actin chromobody)DepositorInsertActin-Vhh-Halo-Tag
UseGateway CloningAvailable sinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC1-lifeact-oROS-HT
Plasmid#216420PurposeTargeting of the chemigenetic, fluorescent peroxide sensor oROS-HT to actin filaments.DepositorPublicationInsertlifeact-oROS-HT
ExpressionMammalianPromoterCMVAvailable sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
PARP2-c098
Plasmid#216873PurposeBacterial expression vector for E. coli producing PARP2 catalytic protein (without Regulatory domain); with N-terminal CFP fusionDepositorInsertPARP2 catalytic domain (no Regulatory Domain) (PARP2 Human)
ExpressionBacterialAvailable sinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCA15-Ubc-NLS- scFV-tdTomato
Plasmid#199446PurposeExpression of scFV-tdTomato that binds to the GCN4 peptide from the SunTag System in mammalian cellsDepositorInsertscFV-tdTomato
UseLentiviralExpressionMammalianPromoterhuman ubiquitin C (UBC)Available sinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only