We narrowed to 5,408 results for: U6
-
Plasmid#217366PurposeExpresses E. coli leucine tRNA and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli leucine tRNA for TAG suppression
UseAAVExpressionMammalianPromoterU6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuideFE-mSG-Puro
Plasmid#226522PurposeCas9 guide RNA scaffold with the F+E scaffold modification with mStayGold-P2A-PuroDepositorInserthU6_SpCas9gRNAF+E_EF1a_mStayGold_P2A_Puro
UseCRISPR and LentiviralTagsmStayGoldExpressionMammalianPromoterU6,EF1aAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hU6-enhanced_gRNA-BFP-P2A-PuroR
Plasmid#230935PurposegRNA cloning vector encoding BFP and puromycin resistanceDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsTagBFPPromoterhU6Available SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRpuro-sgROSA26
Plasmid#231562PurposepLentiCRISPR expression vector for Cas9 and gRNA targeting human ROSA26 locus (Puromycin selection marker)DepositorInsertsgROSA26
UseCRISPR and LentiviralExpressionMammalianPromoterU6, EF-1aAvailable SinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRpuro-sgSEC24C #1
Plasmid#231563PurposepLentiCRISPR expression vector for Cas9 and gRNA targeting human SEC24C (#1) (Puromycin selection marker)DepositorAvailable SinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgTYMS
Plasmid#217430PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human TYMSDepositorAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-mTagBFP2-rMPC1 shRNA
Plasmid#229016PurposeExpression of an shRNA construct that knocks down rat MPC1. This plasmid also encodes a blue fluorescent protein tag to verify transfectionDepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-TCAB1 KI sgRNA
Plasmid#207611PurposesgRNA for HaloTag insertion into the endogenous TCAB1 locusDepositorInsertCCAAAGTCTTCATACTGCAG
TagsNoneExpressionMammalianPromoterCMV and U6Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LC3B sgRNA
Plasmid#207556PurposepX330 expressing Cas9 and a sgRNA targeting the LC3B locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgAMPKa2-Cas9-GFP
Plasmid#208050PurposeLentiviral vector expressing Cas9 and an sgRNA targeting AMPKa2DepositorAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgAMPKa1-Cas9-GFP
Plasmid#208049PurposeLentiviral vector expressing Cas9 and an sgRNA targeting AMPKa1DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGK112
Plasmid#228127PurposeExpress node 1531 retron with split retron ncRNA and gRNA to edit (SNIP + PAM recode) HEK4 gene in human cellsDepositorInsertRetron node 1531 split retron ncRNA and gRNA to edit HEK4 gene (SNP + PAM recode) in human cells
ExpressionMammalianPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGK61
Plasmid#228121PurposeExpress node 1467 retron with split retron ncRNA and gRNA to edit (10bp barcode) EMX1 gene in human cellsDepositorInsertRetron node 1467, split retron ncRNA and gRNA to edit EMX1 gene (10bp barcode) in human cells
ExpressionMammalianPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable SinceDec. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-MYO1C
Plasmid#227305PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of MYO1C for knock-in.DepositorInsertsgRNA Targeting N-terminus of MYO1C (MYO1C Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PCNT
Plasmid#227284PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of PCNT for knock-in.DepositorAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-PEX3
Plasmid#227303PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of PEX3 for knock-in.DepositorAvailable SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-RAB7A
Plasmid#227297PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of RAB7A for knock-in.DepositorInsertsgRNA Targeting N-terminus of RAB7A (RAB7A Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-MAPRE1
Plasmid#207793PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of MAPRE1 for knock-in.DepositorInsertsgRNA Targeting C-terminus of MAPRE1 (MAPRE1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only