We narrowed to 4,275 results for: PRS
-
Plasmid#78715Purposemammalian expression of NHE1DepositorAvailable SinceJune 16, 2016AvailabilityAcademic Institutions and Nonprofits only
-
Gal:mCherry-CRY2-uTEV1Δ(220-242)
Plasmid#135452PurposeYeast expression of uTEV1Δ fused to CRY2 and mCherryDepositorInsertmCherry-CRY2-TEV1Δ(220-242)
TagsmCherryExpressionYeastPromoterGalAvailable SinceJan. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lifeact-3xmNG::TRP1
Plasmid#227593PurposeIntegration vector for expressing Lifeact-3xmNeonGreenDepositorInsertLifeact-3xmNeonGreen::TRP1
Tags3xmNeonGreenExpressionYeastMutationTruncated ABP140 (aa 1-17 only)PromoterAbp140Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHLUM (version 2)
Plasmid#64166Purposeharbours marker genes HIS3, LEU2, URA3 and MET17DepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNCS Citrine
Plasmid#91761PurposeBacterial expression of a fluorescent protein, CitrineDepositorInsertCitrine
TagsHexa-Histidine tag, Xpress epitope for detection …ExpressionBacterialPromoterT7Available SinceJune 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pG3
Plasmid#162604PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pG2
Plasmid#162603PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pL-rpb1-N488D
Plasmid#10988DepositorInsertrpb1-N488D (RPO21 Budding Yeast)
ExpressionBacterial and YeastMutationMutation 1462 A to G in the RPB1 ORF resulting in…Available SinceDec. 16, 2005AvailabilityAcademic Institutions and Nonprofits only -
pBHM2662
Plasmid#234501PurposeLinker-Cno_mNeonGreen-CBP-2xFLAG-CnU6-sgRNA-amdSDepositorInsertmNeonGreen-CBP-2XFLAG-amdS-PCnU6-sgRNA_scaffold
UseCRISPRExpressionBacterial and YeastAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pABY-c15
Plasmid#201768PurposeExpresses mNeonGreen-tagged NbALFA under ADH1 promoter in yeastDepositorInsertNbALFA
Tags40aa Linker, mNeonGreenExpressionYeastPromoterADH1Available SinceAug. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pG4
Plasmid#162605PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pL-rpb1-E1103G
Plasmid#10989DepositorInsertrpb1-E1103G (RPO21 Budding Yeast)
ExpressionBacterial and YeastMutationMutation 3308 A to G in the RPB1 ORF resulting in…Available SinceDec. 16, 2005AvailabilityAcademic Institutions and Nonprofits only -
pTNS2
Plasmid#87802PurposeFor constructing NusA-SUMO-fusion proteins with N-terminal StrepII tag and C-terminal His tag using "blunt-end" cloning.DepositorTypeEmpty backboneTags6xHis and Strep IIExpressionBacterialAvailable SinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTEF-Sup35C
Plasmid#1202DepositorInsertSup35 C-terminus (SUP35 Budding Yeast)
ExpressionYeastMutationSup35 C-terminus ~254aa-endPromoterTEFAvailable SinceMay 25, 2005AvailabilityAcademic Institutions and Nonprofits only -
bRA90
Plasmid#100951PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. LEU2 markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUNIV-EGFP
Plasmid#24706DepositorInsertEGFP (eGFP Aequoria victoria)
ExpressionBacterial, Mammalian, and Y…Available SinceDec. 6, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAG416GPD-Cerulean-YPT31
Plasmid#18849DepositorAvailable SinceNov. 21, 2008AvailabilityAcademic Institutions and Nonprofits only -
csr-1_son-1_mNeonGreen
Plasmid#191743PurposeTest fluorescent properties in Neurospora crassa. Nuclear envelope fluorescent reporter.DepositorInsertNCU04288 (NCU04288 Neurospora crassa)
TagsNCU04502 promoter and mNeonGreenExpressionBacterialAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-X0
Plasmid#115565PurposeControl vector expressing GFP alone without any consensus repeatsDepositorInsertGreen Fluorescent Protein
ExpressionBacterial and YeastPromoterADH1Available SinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only