We narrowed to 13,548 results for: CAR
-
Plasmid#78151PurposeMammalian Expression of the first 219 amino acids of Connexin 32 and EGFP from a bicistronic mRNADepositorInsertConnexin 32 (GJB1 Human)
TagsEGFPExpressionMammalianMutationOnly contains first 219 residuesPromoterCMVAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEN-CAG-mRFP-PCNA pc2729
Plasmid#166040PurposeExpresses mRFP tagged human PCNA in mammalian cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
Alpha MHC-DN.JNK2
Plasmid#51931Purposemammalian expression of dominant negative JNK2DepositorInsertDN JNK2 (Mapk9 Mouse)
TagsHAExpressionMammalianMutationdominant negative: the dual phosphorylation moti…Promotercardiac-specific α-myosin heavy chain 5.5 kb pro…Available SinceJune 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-Necl-5-ScNeo
Plasmid#170283PurposeTo monitor the status of Necl-5, the plasmid encodes a recombinant Necl-5 fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInserta recombinant mouse Necl-5 fused to the mScarlet and to the mNeonGreen fluorescent protein (Pvr Mouse, Synthetic)
TagsmScarlet and mNeonGreenExpressionMammalianAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-PALMDgRNA1+2-cTnT-Cre -mi122TS
Plasmid#216830Purposecardiomyocytes-specific plasmid, expressing gRNAs targeting Palmd exon7, containing a mi122TS sequence to decrease off-target effects in the liver.DepositorInsertPALMDgRNA
UseAAVAvailable SinceAug. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
MARS
Plasmid#205232PurposeExpresses PLEKHA5 aa 143-271 (K163A and R164A) fused to mScarlet-i in mammalian cellsDepositorInsertPLEKHA5 aa 143-271 with K163A and R164A mutations (PLEKHA5 Human)
TagsNuclear Export Sequence and mScarlet-iExpressionMammalianMutationamino acids 143-271 of PLEKHA5 (GenBank reference…PromoterCMVAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
His-ZZ-TEV-BICDR1-GFP
Plasmid#111657PurposeC-terminal GFP tag on BICDR1 for expression in Sf9 cells. 8xHis-ZZ-GFP N-terminal tag, TEV site to cleave 8xHis-ZZ.DepositorInsertBICDR1-GFP (Bicdl1 Mouse)
Tags8xHis-tag, GFP, TEV site, and ZZExpressionInsectMutationOptimised for Sf9 expressionAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmx-MiGT
Plasmid#172397PurposeRetroviral expression vector for murine direct cardiac reprogrammingDepositorAvailable SinceJuly 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-dDIO-lck-smMyc-4x6T
Plasmid#196421PurposeDre-dependent AAV expression of membrane-targeted Myc spaghetti monster reporter preferentially in astrocytes; astrocyte selectivity generated with 4x6T miRNA targeting cassetteDepositorInsertLck-smMyc
UseAAV; Dre/rox; astrocyte-selectiveTagsLckExpressionMammalianPromoterCAGAvailable SinceFeb. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTER GAMMA-TUBULIN shRNA Human
Plasmid#87955Purposereduced the expression of gamma-tubulin in human cellsDepositorInsertsh gamma-tubulin (TUBG1 Human)
TagsNo-tagExpressionMammalianMutationThe protein is a sh-gamma-tubulin resistant gene.…Available SinceOct. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
His-ZZ-TEV-BICDN(1-400)-GFP
Plasmid#111862PurposeC-terminal GFP tag on BICDN (amino acids 1-400) for baculovirus expression in Sf9 cells. 8xHis-ZZ N-terminal tag, TEV site to cleave 8xHis-ZZ.DepositorInsertBICDN(1-400)-GFP (Bicd2 Mouse)
Tags8xHis tag, GFP, and ZZ tagExpressionInsectMutationCodon optimized for Sf9 expressionAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
Hook3(1-522)-SNAPf-Psc-StrepII
Plasmid#111860PurposeC-terminal SNAPf tag on Hook3 (amino acids 1-522) for expression in Sf9 cells. C-terminal SNAPf-Psc-StrepII tag.DepositorInsertHook3(1-552)-SNAPf (HOOK3 Human)
TagsPsc, SNAPf, and Strep-IIExpressionInsectMutationOptimised for expression in Sf9 cellsAvailable SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Hook3(1-522)-GFP-Psc-StrepII
Plasmid#111861PurposeC-terminal GFP tag on Hook3 (amino acids 1-522) for expression in Sf9 cells. C-terminal GFP-Psc-StrepII tag.DepositorInsertHook3(1-552)-GFP (HOOK3 Human)
TagsGFP, Psc tag, and Strep tagExpressionInsectMutationOptimised for expression in SF9 cellsAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1-human LIC1 G domain
Plasmid#74598Purposeused for expression in E. coli and purification. N-terminal GST tag and C-terminal Strep tag, aa 1-389DepositorInserthuman dynein light intermediate chain 1 amino acids 1-389 (DYNC1LI1 Human)
TagsN-terminal GST and Strep IIExpressionBacterialPromoterT7Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.BRWD3-V5H
Plasmid#48624PurposeExpresses Drosophila BRWD3 (with V5 and His tags at the C-terminus) in mammalian cellsDepositorInsertBRWD3 (BRWD3 Fly)
TagsV5 and His tagsExpressionMammalianMutationno mutations, stop was removed to fuse V5His at C…PromoterCMVAvailable SinceOct. 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTYB1-MBD2-N∆GR (pc5083)
Plasmid#230974PurposeBacterial expression plasmid of MBD2-N∆GR. N-terminus of MBD2 lacking the glycine/arginine rich domain: aa75-96. C-terminal tagged to intein.DepositorInsertMBD2 (Mbd2 Mouse)
TagsInteinExpressionBacterialMutationN-terminus of MBD2 lacking the glysine/arginine r…PromoterT7Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTYB1-MBD2∆C∆GR pc5079
Plasmid#229759PurposeBacterial expression plasmid of MBD2∆C∆GR. MBD2 lacking the C-terminus of MBD2: aa 236-414 and the glycine/arginine rich domain: aa 75-96. C-terminal tagged to intein.DepositorInsertMBD2 (Mbd2 Mouse)
TagsInteinExpressionBacterialMutationMBD2 lacking the C-terminus of MBD2: aa 236-414 a…PromoterT7Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTYB1-MBD2-C∆CC pc5084
Plasmid#229761PurposeBacterial expression plasmid of MBD2-C∆CC. C-terminus of MBD2 is lacking the coiled coil domain: aa 363-396. C-terminal tagged to intein.DepositorInsertMBD2 (Mbd2 Mouse)
TagsInteinExpressionBacterialMutationC-terminus of MBD2 is lacking the coiled coil dom…PromoterT7Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmMBD2-N∆GR-G pc5087
Plasmid#229763PurposeMammalian expression plasmid of MBD2-N∆GR. N-terminus of MBD2 lacking the glycine/arginine rich domain: aa75-96. C-terminal tagged to GFP.DepositorInsertMBD2 (Mbd2 Mouse)
TagsGFPExpressionMammalianMutationN-terminus of MBD2 lacking the glycine/arginine r…PromoterCMVAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only