We narrowed to 7,466 results for: Ski;
-
Plasmid#235680PurposeExpress TAZ-CAMTA1 fusion gene in mammalian cells using the doxycycline-inducible TRE promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationPromoterAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ALDOA_sgRNA1
Plasmid#201590PurposeCRISPR/Cas9-mediated gene knock-outDepositorAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP12-AAV-H1/TO-L-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82704PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianMutationPromoterAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP11-AAV-U6/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82705PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianMutationPromoterAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJEP13-AAV-H1/TO-L-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82703PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianMutationPromoterAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pscALPSblasti-TMPRSS2 Blasti
Plasmid#158088PurposeExpresses TMPRSS2 in mammalian cellsDepositorAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK-hACE2
Plasmid#161612PurposeExpression of human ACE2 in mammalian cellsDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterPGKAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLEX-HA-birA*-K-Ras(G12D)-IRES-Puro
Plasmid#120562PurposeExpresses HA-birA*-K-Ras G12D fusion protein in mammalian cells & for virus productionDepositorInsertKRAS4B (KRAS Human)
UseLentiviralTagsHA-birA*ExpressionMammalianMutationG12DPromoterCMVAvailable SinceMarch 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS D614 soluble Spike
Plasmid#164652PurposeExpresses SARS-CoV-2 soluble Spike proteinDepositorInsertSARS-CoV-2 soluble spike (S SARS-CoV-2)
UseTagsHISExpressionMammalianMutationPromoterCAGAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only