We narrowed to 13,943 results for: CAR
-
Plasmid#110161PurposeExpression of human eEF2K (S441A/S445A) in mammalian cellsDepositorInserteEF2K (eukaryotic elongation factor 2 kinase) (EEF2K Human)
TagsHAExpressionMammalianMutationS441A/S445APromoterCMVAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Myh6-Cas9
Plasmid#109037PurposeCardiac-specific overexpression of Cas9DepositorInsertCas9
Tags3XFlagExpressionMammalianPromoteralpha MHCAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
Cx32R220stop
Plasmid#78151PurposeMammalian Expression of the first 219 amino acids of Connexin 32 and EGFP from a bicistronic mRNADepositorInsertConnexin 32 (GJB1 Human)
TagsEGFPExpressionMammalianMutationOnly contains first 219 residuesPromoterCMVAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
Alpha MHC-DN.JNK2
Plasmid#51931Purposemammalian expression of dominant negative JNK2DepositorInsertDN JNK2 (Mapk9 Mouse)
TagsHAExpressionMammalianMutationdominant negative: the dual phosphorylation moti…Promotercardiac-specific α-myosin heavy chain 5.5 kb pro…Available SinceJune 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEN-CAG-mRFP-PCNA pc2729
Plasmid#166040PurposeExpresses mRFP tagged human PCNA in mammalian cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-Necl-5-ScNeo
Plasmid#170283PurposeTo monitor the status of Necl-5, the plasmid encodes a recombinant Necl-5 fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInserta recombinant mouse Necl-5 fused to the mScarlet and to the mNeonGreen fluorescent protein (Pvr Synthetic, Mouse)
TagsmScarlet and mNeonGreenExpressionMammalianAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-PALMDgRNA1+2-cTnT-Cre -mi122TS
Plasmid#216830Purposecardiomyocytes-specific plasmid, expressing gRNAs targeting Palmd exon7, containing a mi122TS sequence to decrease off-target effects in the liver.DepositorInsertPALMDgRNA
UseAAVAvailable SinceAug. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
His-ZZ-TEV-BICDR1-GFP
Plasmid#111657PurposeC-terminal GFP tag on BICDR1 for expression in Sf9 cells. 8xHis-ZZ-GFP N-terminal tag, TEV site to cleave 8xHis-ZZ.DepositorInsertBICDR1-GFP (Bicdl1 Mouse)
Tags8xHis-tag, GFP, TEV site, and ZZExpressionInsectMutationOptimised for Sf9 expressionAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmx-MiGT
Plasmid#172397PurposeRetroviral expression vector for murine direct cardiac reprogrammingDepositorAvailable SinceJuly 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-dDIO-lck-smMyc-4x6T
Plasmid#196421PurposeDre-dependent AAV expression of membrane-targeted Myc spaghetti monster reporter preferentially in astrocytes; astrocyte selectivity generated with 4x6T miRNA targeting cassetteDepositorInsertLck-smMyc
UseAAV; Dre/rox; astrocyte-selectiveTagsLckExpressionMammalianPromoterCAGAvailable SinceFeb. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTER GAMMA-TUBULIN shRNA Human
Plasmid#87955Purposereduced the expression of gamma-tubulin in human cellsDepositorInsertsh gamma-tubulin (TUBG1 Human)
TagsNo-tagExpressionMammalianMutationThe protein is a sh-gamma-tubulin resistant gene.…Available SinceOct. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
Hook3(1-522)-SNAPf-Psc-StrepII
Plasmid#111860PurposeC-terminal SNAPf tag on Hook3 (amino acids 1-522) for expression in Sf9 cells. C-terminal SNAPf-Psc-StrepII tag.DepositorInsertHook3(1-552)-SNAPf (HOOK3 Human)
TagsPsc, SNAPf, and Strep-IIExpressionInsectMutationOptimised for expression in Sf9 cellsAvailable SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Hook3(1-522)-GFP-Psc-StrepII
Plasmid#111861PurposeC-terminal GFP tag on Hook3 (amino acids 1-522) for expression in Sf9 cells. C-terminal GFP-Psc-StrepII tag.DepositorInsertHook3(1-552)-GFP (HOOK3 Human)
TagsGFP, Psc tag, and Strep tagExpressionInsectMutationOptimised for expression in SF9 cellsAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1-human LIC1 G domain
Plasmid#74598Purposeused for expression in E. coli and purification. N-terminal GST tag and C-terminal Strep tag, aa 1-389DepositorInserthuman dynein light intermediate chain 1 amino acids 1-389 (DYNC1LI1 Human)
TagsN-terminal GST and Strep IIExpressionBacterialPromoterT7Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.BRWD3-V5H
Plasmid#48624PurposeExpresses Drosophila BRWD3 (with V5 and His tags at the C-terminus) in mammalian cellsDepositorInsertBRWD3 (BRWD3 Fly)
TagsV5 and His tagsExpressionMammalianMutationno mutations, stop was removed to fuse V5His at C…PromoterCMVAvailable SinceOct. 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTYB1-MBD2∆N∆CC (pc5082)
Plasmid#232745PurposeBacterial expression plasmid of MBD2-∆N∆CC. MBDTRD and C-terminus of MBD2 is lacking the coiled coil domain: aa 363-396. C-terminal tagged to intein.DepositorInsertMBD2 (Mbd2 Mouse)
TagsGFPExpressionMammalianMutationMBD2 lacking the C-terminus (a 236-414)PromoterT7Available SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGmMBD1.4 (pc3305)
Plasmid#246851PurposeMammalian expression plasmid of mouse MBD1 lacking the MBD domain (aa 75–636). N-terminal tagged to GFP.DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFRT-B-RPCNA (pc1205)
Plasmid#247000PurposeThis pFRT-B plasmid enables the creation of a stable mammalian cell line expressing RFP-tagged PCNA .DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFRT-B-GPCNA (pc1274)
Plasmid#247001PurposeThis pFRT-B plasmid enables the creation of a stable mammalian cell line expressing GFP-tagged PCNADepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only