We narrowed to 9,681 results for: SUB;
-
Plasmid#72035PurposeExpresses the extracellular region of the Sema5A protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pBAD-HisD-mNG-C-Kbp
Plasmid#178013PurposeBacterial expression of green fluorescent potassium indicator mNG-C-KbpDepositorInsertmNG-C-Kbp
ExpressionBacterialPromoteraraBAvailable SinceDec. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-HisD-mNG-Pa-Kbp
Plasmid#178014PurposeBacterial expression of green fluorescent potassium indicator mNG-Pa-KbpDepositorInsertmNG-Pa-Kbp
ExpressionBacterialPromoteraraBAvailable SinceDec. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-HisD-mNG-Hv-Kbp
Plasmid#178015PurposeBacterial expression of green fluorescent potassium indicator mNG-Hv-KbpDepositorInsertmNG-Hv-Kbp
ExpressionBacterialPromoteraraBAvailable SinceDec. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-HisD-mNG-D-Kbp
Plasmid#178012PurposeBacterial expression of green fluorescent potassium indicator mNG-D-KbpDepositorInsertmNG-D-Kbp
ExpressionBacterialPromoteraraBAvailable SinceDec. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-FKBP-SAC1-HLx10
Plasmid#108137PurposeRecruitable SAC1 with extended linkerDepositorInsertmCherry:FKBP1A(3-108):[GGSA]4GG:SACM1L(1-520):[EAAAR]10:SACM1L(521-587) (SACM1L Human)
ExpressionMammalianMutationSACM1L(1-520):[EAAAR]10:SACM1L(521-587)PromoterCMVAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
Sema4b-Fc-His
Plasmid#72155PurposeExpresses the extracellular region of the Sema4B protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nrp1-AP-His
Plasmid#71971PurposeExpresses the extracellular region of the Neuropilin 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Sema3d(L)-AP-His
Plasmid#72017PurposeExpresses the Sema3D protein (truncated at cleavage site P3; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGMC00013
Plasmid#172525PurposesgRNA against mouse Mr1DepositorAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
Plxnb3-Fc-His
Plasmid#72130PurposeExpresses the extracellular region of the PlexinB3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET19b-MED17
Plasmid#15412DepositorAvailable SinceAug. 10, 2007AvailabilityAcademic Institutions and Nonprofits only -
FUW-M2-PAK2 S20A
Plasmid#31664DepositorInsertp21-activated protein kinase 2 S20A (PAK2 Human)
UseLentiviralTagsM2ExpressionMammalianMutationChanged Serine 20 to AlanineAvailable SinceApril 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDEST_FLAG-HUWE1_YH/GG
Plasmid#187123Purposemammalian cell expression of FLAG-HUWE1 Y355G/H356GDepositorAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
MAC_N_GSK3B
Plasmid#111687PurposeMAC-tagged gene expressionDepositorInsertGSK3B (GSK3B Human)
ExpressionMammalianAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cntn4.2-AP-His
Plasmid#71942PurposeExpresses the entire Contactin 2, isoform 2 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3f(S, +)-AP-His
Plasmid#72023PurposeExpresses the Sema3F protein (truncated at cleavage site P1; ie, short and contains no deletion in exon 3), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-sCAG-GluClβ.CreON
Plasmid#196996PurposeCre recombinase dependent expression of GluClv2.0 beta subunit. GluClβ contains a YFP tag. When co-expressed with GluClv2.0 alpha subunit, agonist (Ivermectin) induces neuronal silencing.DepositorInsertGluClβ -YFP
UseAAV and Cre/LoxTagsYFPPromotershort CAGAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1 UBXN11
Plasmid#169017PurposeExpresses GST-UBXN11 (human) in bacteriaDepositorAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only