We narrowed to 88,257 results for: Mal
-
Plasmid#102447PurposeExpresses FLAG-tagged human LPL in mammalian cellsDepositorInsertLipoprotein lipase (LPL Human)
UseTags6x His and FLAGExpressionMammalianMutationPromoterCMVAvailable SinceMay 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
PD-L1-miSFIT-Ce67
Plasmid#124686PurposeTuning expression of PD-1DepositorAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_KLF16_P2A_Hygro_Barcode
Plasmid#120502PurposeBarcoded lentiviral vector to express KLF16 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
PD-1-miSFIT-1x
Plasmid#124679PurposeTuning expression of PD-1DepositorAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFRLuc-CoV2-delSS
Plasmid#177615PurposeDual luciferase reporter for SARS-CoV-2 programmed -1 ribosomal frameshifting. Slippery sequence (SS) deleted (negative control).DepositorInsertSARS-CoV-2 FSE
UseLuciferaseTagsExpressionMammalianMutationSlippery sequence deletedPromoterAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
SNAP-CLC-EGFP
Plasmid#193579PurposeExpresses human Clathrin Light Chain B tagged with SNAP-tag and mEGFP in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
UseTagsSNAP-tag and mEGFPExpressionMammalianMutationPromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
NKP90 RFP (787)
Plasmid#62001Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-mClover3-MAP4-MTBD
Plasmid#171498PurposeT7 promotor drives in vitro transcription of mClover3-tagged mouse MAP4-Microtubule Binding Domain mRNADepositorAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV_FLAG-NFL(R438TAG)
Plasmid#182662PurposeExpresses mouse neurofilament light chain with a TAG codon at the position R438 and an N-terminal FLAG tag (DYKDDDDK) in mammalian cells.DepositorInsertmouse neurofilament light chain with a R438TAG mutation (Nefl Mouse)
UseTagsFLAG tag (DYKDDDDK)ExpressionMammalianMutationR438TAGPromoterCMVAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
LITE2.0 EF1a_TALE(Neurog2)-GS-CIB1(NLS*,∆318-334)_WPRE_hGHpA
Plasmid#47458PurposeLITE2.0 TALE-CIB1. Changes from LITE1.0: glycine-serine linker, mutated endogenous NLS, aa318-334 deletion. This particular TALE targeted to Neurog2. EF1-alpha promoter for ubiquitous mammalian exp.DepositorInsertTALE (Neurog2)-GS-CIB1(NLS*,∆318-334)
UseTagsHAExpressionMammalianMutationPromoterEF1-alphaAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GST FNIP2
Plasmid#164982PurposeFNIP2 expressing vector for mammalian cellsDepositorAvailable SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC33
Plasmid#62330PurposesgRNA + 2x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDNA_B2AR-i-pep
Plasmid#47436PurposeFRET sensor for beta2-adrenergic receptorDepositorInsertbeta2-adrenergic receptor (ADRB2 Human)
UseTags10 nm ER/K helix, HA, i-pep, mCerulean, and mCitr…ExpressionMammalianMutationPromoterpCMVAvailable SinceSept. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pNH-TrxT-G-S18
Plasmid#127827PurposeProduction of recombinant human ribosomal protein S18DepositorInsertRPS18 (RPS18 Human)
UseTagsHis6 - Thioredoxin - TEVExpressionBacterialMutationPromoterT7Available SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-Hygro-Myc-hAgo2
Plasmid#60234PurposeExpress HA-tagged wild-type Ago2 in mammalian cells in a Dox-inducible mannerDepositorAvailable SinceNov. 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MESP1_P2A_Hygro_Barcode
Plasmid#120459PurposeBarcoded lentiviral vector to express MESP1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
LV_EF1a_CDK4-P2A-Hygro_Barcode
Plasmid#170223PurposeBarcoded lentiviral vector to express CDK4 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seqDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-P2A-CIAR_pLenti_CMV_Puro
Plasmid#86503PurposeLenti plasmid for generating CIAR expressing stable cell linesDepositorInsertGFP-P2A-CIAR (SOS1 Human)
UseLentiviralTagsExpressionMammalianMutationT968L in SOScatPromoterCMVAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1_HBB_N
Plasmid#87847PurposepCR2.1-based plasmid holding a 309-bp fragment containing the exon-1-exon-2 splice border of normal human β-globin mRNADepositorInsertHomo sapiens hemoglobin subunit beta (HBB), Normal cDNA fragment (Exon1/2) (HBB Human)
UseTagsExpressionBacterialMutationPromoterAvailable SinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only