We narrowed to 4,562 results for: abo
-
Plasmid#55193PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-11. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(159-238)-gamma-11 (GNG11 Aequorea victoria, Bovine)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-11 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pVQ CMV NanoV1-2a-EGFP ferritin
Plasmid#79649PurposeExpresses camelid anti-GFP nanobody fused to TRPV1 and GFP-ferritin chimera fusion proteinDepositorInsertsUseAdenoviralExpressionMammalianPromoterCMVAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVQ CMV NanoV1Mutant-2a-EGFP ferritin
Plasmid#79650PurposeExpresses camelid anti-GFP nanobody fused to TRPV1 with mutant pore region and GFP-ferritin chimera fusion proteinDepositorInsertsUseAdenoviralExpressionMammalianMutationisoleucine 679 changed to lysinePromoterCMVAvailable SinceSept. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
DRH031_ AAV-SIO-nEF-WT-THR
Plasmid#225090PurposeCre-dependent expression of wild-type thyroid receptor beta (THRB, human) in neurons driven by nEF promoter.DepositorInsertDN-THRB (THRB Human)
UseAAVAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
DRH032_ AAV-SIO-nEF-DN-THR
Plasmid#225091PurposeCre-dependent expression of dominant-negative thyroid receptor beta (THRB, human) in neurons driven by nEF promoter.DepositorInsertWT-THRB (THRB Human)
UseAAVAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-HDRT-CD3z-truncCARgsg(anti-CD19)
Plasmid#215759PurposeHDR template to insert a truncated CD3-zeta-deficient CD19-CAR into CD247 exon 2 (enhanced expression by GSG-2A linker)DepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-beta-1 in pcDNAI/Amp
Plasmid#54468PurposeAn amino-terminal YFP fragment was fused to Gbeta-1. When co-expressed with a carboxyl-terminal YFP or CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertYFP (1-158)/beta-1 (GNB1 Aequorea victoria, Human)
TagsYFP(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationGBeta-1 was amplified via PCR, which removed an i…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-beta-2 in pcDNAI/Amp
Plasmid#54469PurposeAn amino-terminal YFP fragment was fused to Gbeta-2. When co-expressed with a carboxyl-terminal YFP or CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertYFP(1-158)/beta-2 (GNB2 Aequorea victoria, Human)
TagsYFP(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationYFP (1-158) includes a substitution of Met for Gl…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-beta-5 in pcDNAI/Amp
Plasmid#54470PurposeAn amino-terminal YFP fragment was fused to Gbeta-5. When co-expressed with a carboxyl-terminal YFP or CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertYFP(1-158)/beta-5 (GNB5 Aequorea victoria, Human)
TagsYFP(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationYFP (1-158) includes a substitution of Met for Gl…Available SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(159-238)-beta-1 in pcDNAI/Amp
Plasmid#55592PurposeA carboxyl-terminal CFP fragment was fused to Gbeta-1. When co-expressed with an amino-trerminal CFP or YFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertCFP (159-238)-Beta 1 (GNB1 Aequorea victoria, Human)
TagsCFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationCFP(159-238) includes a substitution of His for A…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1alpha-FLAG-HA-CAD_WT-HA-IRES-Neo
Plasmid#253784PurposepLenti lentiviral expression vector encoding FLAG- and HA-tagged human wild-type CAD linked to neomycin selection by an IRES under a human EF1alpha promoter.DepositorAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-FLAG-HA-CAD_WT-HA-Hygro
Plasmid#253792PurposepLenti lentiviral expression vector encoding FLAG- and HA-tagged human wild-type CAD under a human PGK promoter.DepositorAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1alpha-FLAG-HA-CAD_WT-HA-IRES-Neo
Plasmid#253788PurposepLV lentiviral expression vector encoding FLAG- and HA-tagged human wild-type CAD linked to neomycin selection by an IRES under a human EF1alpha promoter.DepositorAvailable SinceMarch 31, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-EGFP-MTHFD1-WPRE
Plasmid#250370PurposeLentiviral expression of human MTHFD1 with N-terminal EGFP under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19-HDRT-CD3z-truncCAR(anti-CD19)
Plasmid#215758PurposeHDR template to insert a truncated CD3-zeta-deficient CD19-CAR into CD247 exon 2DepositorAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUltra-MDH1-ME1
Plasmid#184465PurposeLentiviral vector for tri-cistronic expression of EGFP, MDH1 and ME1 (seperated by P2A and T2A)DepositorUseLentiviralTagsfused to T2AExpressionMammalianMutationdeletion of stop codonPromoterUbCAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLPC-puromycin-binary-MDH1-3xFLAG-ME1- HA
Plasmid#184549PurposeRetroviral vector to co-express human MDH1 with 3xFLAG tag and human ME1 with HA tagDepositorUseRetroviralTags3xFLAG and HA tagExpressionMammalianPromoterCMVAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1alpha-FLAG-HA-CAD_S1900A-HA-IRES-Neo
Plasmid#253789PurposepLV lentiviral expression vector encoding FLAG- and HA-tagged human CAD bearing S1900A mutation linked to neomycin selection by an IRES under a human EF1alpha promoter.DepositorInsertCAD (CAD Human)
UseLentiviralTagsFLAG-HA and HAExpressionMammalianMutationS1900APromoterEF1alphaAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1alpha-FLAG-HA-CAD_S1900A-HA-IRES-Neo
Plasmid#253785PurposepLenti lentiviral expression vector encoding FLAG- and HA-tagged human CAD bearing S1900A mutation linked to neomycin selection by an IRES under a human EF1alpha promoter.DepositorInsertCAD (CAD Human)
UseLentiviralTagsFLAG-HA and HAExpressionMammalianMutationS1900APromoterEF1alphaAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only