We narrowed to 538 results for: CAG synthetic promoter
-
Plasmid#253882PurposeComponents for Integration Vectors: mMoClo TUPV, with TRE3GV promoter and HIF1a* in the MCSDepositorInsertHIF1a*
UseSynthetic BiologyExpressionMammalianPromoterTRE3GVAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1043 TRE3GV mTagBFP2
Plasmid#253903PurposeComponents for Integration Vectors: mMoClo TUPV, with TRE3GV promoter and mTagBFP2 in the MCSDepositorInsertmTagBFP2
UseSynthetic BiologyExpressionMammalianPromoterTRE3GVAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1354 TRE3GV LumiScarlet in TU1
Plasmid#253905PurposeComponents for Integration Vectors: mMoClo TUPV, with TRE3GV promoter and LumiScarlet in the MCSDepositorInsertLumiScarlet
UseSynthetic BiologyTags3xFLAGExpressionMammalianPromoterTre3GVAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pmEmerald_mEmerald_I3
Plasmid#231681PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with two tandem mEmeralds in mammalian cells. Assembles into nanocages tagged with 120 mEmerald FPs.DepositorInsertI3-01
TagsmEmeraldExpressionMammalianMutationK129APromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmEmerald_I3
Plasmid#231680PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with one mEmerald in mammalian cells. Assembles into nanocages tagged with 60 mEmerald FPs.DepositorInsertI3-01
TagsmEmeraldExpressionMammalianMutationK129APromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCLYBL-Neo_TRE3VG_mCherry_Responder
Plasmid#230054PurposeIt presents the TRE3VG inducible promoter allowing the dox-dependent inducible activation of mCherry through the OPTi-OX platform. The CLYBL GSH supports higher transgene expressionDepositorInsertTRE3VG_mCherry
ExpressionMammalianPromoterTRE3VGAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 probasin_mTQ2_FlpO
Plasmid#68357PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and 8, and SMAD4 ex2 and ex 9 are expressed by the U6 promoter.DepositorInserts5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterU6 and synthetic Probasin ARRx2Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBigTB-CreERT2
Plasmid#149434Purposetamoxifen-inducible Cre recombinaseDepositorInsertCre-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianPromoterCAG promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_DRS-1 sgRNA / hSpCas9
Plasmid#172841PurposeMammalian expression of the DRS-1 synthetic sgRNA sequence under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertDRS-1 sgRNA under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJM465 EF1α 3xFLAG-NLS-VP64-ZF1 in TUPV2
Plasmid#161533PurposeConstitutive expression of 3xFLAG-NLS-VP64-ZF1 under the EF1α promoterDepositorInsert3xFLAG-NLS-VP64-ZF1
UseSynthetic BiologyTags3x-FLAGExpressionMammalianPromoterEF1αAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPD774 HBS CMV_min DsRE2 in TUPV1
Plasmid#253885PurposeComponents for Integration Vectors: mMoClo TUPV, with HBS(CMV_min) promoter and DsRE2DepositorInsertDsRE2
UseSynthetic BiologyExpressionMammalianPromoterHBS(CMV_min)Available SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1284 HBS(Ben) mHIF1beta in TU3
Plasmid#253914PurposeComponents for Integration Vectors: mMoClo TUPV, with HBS(YB_TATA) promoter and mHIF1_ in the MCSDepositorInsertHBS(YB_TATA) mHIF1_
UseSynthetic BiologyExpressionMammalianPromoterHBS(YB_TATA)Available SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1359 HBS(YBTATA) LumiScarlet in TU4
Plasmid#253911PurposeComponents for Integration Vectors: mMoClo TUPV, with HBS(YB_TATA) promoter and LumiScarlet in the MCSDepositorInsertHBS(YB_TATA) LumiScarlet
UseSynthetic BiologyTags3xFLAGExpressionMammalianPromoterHBS(YB_TATA)Available SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1352 HBS(SV40) LumiScarlet
Plasmid#253907PurposeComponents for Integration Vectors: mMoClo TUPV, with HBS(SV40_min) promoter and LumiScarlet in the MCSDepositorInsertHBS(SV40_min) LumiScarlet
UseSynthetic BiologyTags3xFLAGExpressionMammalianPromoterHBS(SV40_min)Available SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1271 HBS(Ben) mHIF1a in TU2
Plasmid#253912PurposeComponents for Integration Vectors: mMoClo TUPV, with HBS(YB_TATA) promoter and mHIF1_ in the MCSDepositorInsertHBS(YB_TATA) mHIF1_
UseSynthetic BiologyExpressionMammalianPromoterHBS(YB_TATA)Available SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1272 HBS(Ben) mHIF2a in TU2
Plasmid#253913PurposeComponents for Integration Vectors: mMoClo TUPV, with HBS(YB_TATA) promoter and mHIF2_ in the MCSDepositorInsertHBS(YB_TATA) mHIF2_
UseSynthetic BiologyExpressionMammalianPromoterHBS(YB_TATA)Available SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only