We narrowed to 4,467 results for: Erf
-
Plasmid#170742PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pFA0055
Plasmid#131774PurposeGuide RNA (gCASS5a) and Cas9 expression plasmid for cleaving pFA6 series deletion cassettes, including KanMX, hphMX and natMX. Used to perform CRISPR-Swap of alleles.DepositorInsert20mer CASS5a guide (gCASS5a) and 5' sgRNA
ExpressionBacterial and YeastAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pST_AfrLEA3m (pBS0911)
Plasmid#185285PurposeFor the mammalian expression of the brine shrimp protein AfrLEA3m. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertAfrLEA3m
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_PvLEA4_repeats_k3_26 (pBS0762)
Plasmid#185244PurposeFor the mammalian expression of the sleeping chironomid protein PvLEA4_repeats_k3_26. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertPvLEA4_repeats_k3_26
ExpressionMammalianAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_25G
Plasmid#91144PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA , Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-SID4X-pU6-sgRNA
Plasmid#158989PurposeVector F encodes pAAV-pMecp2-dSaCas9-SID4X-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR interference in neuronsDepositorInsertdSaCas9-SID4X
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf166
Plasmid#12854PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf166
ExpressionMammalianAvailable SinceDec. 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
pST_MAHS_RAMVA (pBS0310)
Plasmid#185169PurposeFor the mammalian expression of the tardigrade protein MAHS_RAMVA. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertMAHS_RAMVA
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_DHN_AtCor47 (pBS0784)
Plasmid#185254PurposeFor the mammalian expression of the Arabidopsis protein DHN_AtCor47. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertDHN_AtCor47
ExpressionMammalianAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAtCas9-dead_2
Plasmid#91166PurposeCas9 only expression, Cas9 Type: AtCas9_D10A+H840A (dead), Plant Selection: 2x35S:npt IIDepositorInsertAtCas9_D10A+H840A (dead)
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti.hUbC.H2B-CeruleanFP-2A-Dendra2FP.W
Plasmid#126522PurposeLentivector that expresses H2B-Cerulean and Dendra2 fluorescent proteins from an internal hUbC promoter.DepositorInsertH2B-CeruleanFP-2A-Dendra2FP
UseLentiviralPromoterhUbCAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAtCas9-dead_1
Plasmid#91165PurposeCas9 only expression, Cas9 Type: AtCas9_D10A+H840A (dead), Plant Selection: 2x35S:hpt IIDepositorInsertAtCas9_D10A+H840A (dead)
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf98
Plasmid#12786PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf98
ExpressionMammalianAvailable SinceDec. 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf144
Plasmid#12832PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf144
ExpressionMammalianAvailable SinceDec. 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAtCas9-dead_3
Plasmid#91167PurposeCas9 only expression, Cas9 Type: AtCas9_D10A+H840A (dead), Plant Selection: 2x35S:barDepositorInsertAtCas9_D10A+H840A (dead)
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
TDK promoter dCas9
Plasmid#113657PurposedCas9 expression unit plasmid. The dCas9 expression unit plasmids contain connector ConL1, ConRE, and one dCas9 transcriptional unit.DepositorInsertTDK gene promoter and dCas9
UseCRISPRExpressionBacterialPromoterTDK gene promoterAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28a-Hook3 I136A, I139A, M142A
Plasmid#74617PurposeExpresses a triple mutant truncation of Hook3 in bacteria for purificationDepositorInserthuman Hook3 amino acids 1-239, I136A, I139A, M142A (HOOK3 Human)
Tags6x His, Strep II, and superfolder GFPExpressionBacterialMutationD102A, E108APromoterT7Available SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf159
Plasmid#12847PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf159
ExpressionMammalianAvailable SinceDec. 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
LLP1017
Plasmid#239939PurposeCaMV 35S driving the expression of dCas9-ZAT10(1x)DepositorInsertCaMV 35S::dCas9-ZAT10(1x)
UseCRISPR and Synthetic BiologyMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only