We narrowed to 10,180 results for: yeast
-
Plasmid#235731PurposeProtein expression in FL yeast VPS34 D731N mutant in yeastDepositorInsertVPS34
ExpressionYeastMutationS2A, D731NAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Nat
Plasmid#232094PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWR58
Plasmid#202795Purposeintegrating bioluminescene reporter for Cas9 activity in S. stipitisDepositorInsertsP-TDH3/coCBG(first portion)-YUM1
P-TEF1/ShBle/T-ACT1
YUM1-coCBG(last portion)/T-ADH2
URA3 and flanking sequence
ExpressionYeastAvailable SinceDec. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCL390
Plasmid#219500PurposeIntegrating inducible cassette (Cas9-P2A-Csy4 and Eco1 RT) for yeast overexpressionDepositorInsertIntegrating inducible cassette: Cas9-P2A-Csy4 and Eco1 RT
TagsSV40-NLSExpressionYeastPromoterGAL1-GAL10Available SinceMay 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHYX143
Plasmid#202816PurposeControl plasmid expressing mScarlet-I fluorescent protein.DepositorInsertmScarlet-I
ExpressionYeastPromoterScPCK1Available SinceNov. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHYX173
Plasmid#202817PurposePlasmid expressing the TEV protease, codon-optimized for Saccharomyces cerevisiae.DepositorInsertTEV protease
ExpressionYeastPromoterScPCK1Available SinceNov. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGADT7-AP-4 β4
Plasmid#198327PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-4 β4 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-4 β4
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastMutationContains L480S substitutionPromoterADH1Available SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGADT7-AP-1 σ1C
Plasmid#198336PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-1 σ1C fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-1 σ1C
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastMutationS148C substitutionPromoterADH1Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACT2-AP-3 σ3A
Plasmid#198347PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-3 σ3A fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-3 σ3A
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastPromoterADH1Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACT2-AP-3 σ3B
Plasmid#198348PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-3 σ3B fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-3 σ3B
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastPromoterADH1Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCL.005
Plasmid#184971PurposeExpress Cas9 in yeastDepositorInsertIntegrating inducible cassette: Cas9
TagsSV40NLSExpressionYeastPromoterGal1-10Available SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9339 (pgRNA_VII-1_NatMX)
Plasmid#161591PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site VII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9340 (pgRNA_VIII-1_NatMX)
Plasmid#161592PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site VIII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9341 (pgRNA_IX-1_NatMX)
Plasmid#161593PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site IX-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9342 (pgRNA_XIII-1_NatMX)
Plasmid#161594PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XIII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9343 (pgRNA_XV-1_NatMX)
Plasmid#161595PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XV-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9344 (pgRNA_XVI-1_NatMX)
Plasmid#161596PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XVI-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only