We narrowed to 167,150 results for: addgene
-
Plasmid#11648PurposeTet-regulated (Tet-on) lentiviral vector for transgene (hPrion promoter) - OR - shRNA (H1 promoter when subcloned from pLVTHM (Addgene#12247)) - 2nd generationDepositorInserthPrion, GFP, tTR-KRAB, Tet-on
UseLentiviralExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-CXCR4 (neo)
Plasmid#192077PurposeLentivirus for expression of CXCR4DepositorAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
MXS_CMV::ZeoR-bGHpA
Plasmid#62441PurposeMXS_chaining vector with CMV::ZeoR-bGHpADepositorInsertresistance cassette against Zeocin with CMV Promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-mRFP1-Human UTROPHIN_1-261
Plasmid#225052PurposeExpress in mammalian cells the mRFP1 fused to residues 1-261 of Human Utrophin to detect filamentous actin in live, fix cels or tissues.DepositorInsertHuman Utrophin residues 1-261 and RFP1 (UTRN Human, Homo Sapiens)
UseLentiviralTagsHuman UTROPHIN 1-261 and mRFP1ExpressionMammalianMutationSequence is derived from ADDGENE Plasmid #26739-R…PromoterCMV promoter and enhancerAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-EGFP-Human-UTROPHIN_1-261
Plasmid#222393PurposeExpress in mammalian cells the EGFP fused to residues 1-261 of Human Utrophin to detect filamentous actin in live, fix cels or tissues.DepositorInsertHuman Utrophin residues 1-261 and EGFP (UTRN Human, Homo Sapiens)
UseLentiviralTagsEGFP and Human UTROPHIN 1-261ExpressionMammalianMutationSequence is derived from ADDGENE Plasmid #26737-G…PromoterCMV promoter and enhancerAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVPT-rtTR-KRAB
Plasmid#11777PurposeTet-regulated (Tet-off) lentiviral vector for transgene (mPGK promoter) - AND/OR - shRNA (H1 promoter when subcloned from pLVTHM (Addgene#12247)) - 2nd generationDepositorInsertmPGK, GFP, rtTR-KRAB, Tet-off
UseLentiviralExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA-Lib
Plasmid#53121PurposesgRNA expression construction in a 3rd generation lentiviral backboneDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMay 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSNAPf-Nup43
Plasmid#98276Purposemammalian expression of SNAPf-Nup43DepositorAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-Stuffer-HepmCherry
Plasmid#192825PurposeContains stuffer sequence into which sgRNAs can be cloned and expresses mCherry from hepatocyte-specific promoterDepositorInsertmCherry
UseCRISPR and LentiviralExpressionMammalianPromoterHepatocyte-specific promoter (HS-CRM8-TTRmin modu…Available SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only