We narrowed to 4,585 results for: NAP
-
Plasmid#118815PurposeT7 RNAP-driven expression of N-terminal His-tagged lacZ omega subunit.DepositorInsertlacZ_
TagshistagExpressionBacterialAvailable SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
Crimson/P2A-ICP8 (pSLIK1)
Plasmid#113856PurposeFor Doxycycline-inducible expression of ICP8 synaptase, with red fluorescent protein gene E2-Crimson-P2A-ICP8DepositorInsertICP8
UseLentiviralTagsP2A/CrimsonAvailable SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GluA2-scFv-mNeon-KDEL
Plasmid#230057PurposeAAV plasmid that expresses a a single chain variable fragment (scFv) for anti- GluA2 with a C-terminal mNeon. Encodes an ER retrieval motif (KDEL) at C-terminus of mNeon.DepositorInsertAnti-GluA2 single chain variable fragment (scFv)
UseAAVTagsER retrieval motif (KDEL) and mNeonExpressionMammalianPromoterhuman synapsinAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBT138b-proB
Plasmid#138515PurposeP3fDepositorInsertT7-RNAP
UseSynthetic BiologyAvailable SinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMR-A-5
Plasmid#138519PurposeP3cDepositorInsertT7-RNAP
UseSynthetic BiologyAvailable SinceJuly 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDB007ns2a
Plasmid#99214PurposeAccessory plasmid for PACE of PylRS variants; negative selectionDepositorInsertPpsp [SD8] gIII; PproK tyrT(Opt,CUA); Ptet [SD4] T7RNAP(S12*,S203*)
Mutationamber codons at positions 12 and 203 of T7 RNA po…PromoterPpsp, PproK, and PtetAvailable SinceOct. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
ICP8-P2A/Crimson (pSLIK4)
Plasmid#113859PurposeFor Doxycycline-inducible expression of ICP8 synaptase gene, with ICP8-P2A-red fluorescent protein gene E2-CrimsonDepositorInsertICP8
UseLentiviralTagsP2A/CrimsonAvailable SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GluA1-scFv-mNeon-KDEL
Plasmid#230056PurposeAAV plasmid that expresses a single chain variable fragment (scFv) for anti-GluA1 tagged with mNeon. Encodes an ER retrieval motif (KDEL) at C-terminus of mNeon.DepositorInsertAnti-GluA1 single chain variable fragment (scFv)
UseAAVTagsER retrieval motif (KDEL) and mNeonExpressionMammalianPromoterhuman synapsinAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-DiO-eGFP-2A-mCherry_D4H
Plasmid#194880PurposeRatiometric D4H sensor for in vivo cre-dependent neuron-specific cholesterol visualizationDepositorInsertGFP-T2A-mCherry-D4H
UseAAV and Cre/LoxExpressionMammalianPromoterhuman SynapsinAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GluA1-scFv-Halo
Plasmid#230055PurposeAAV plasmid that expresses a single chain variable fragment (scFv) for anti-GluA1 fused to halotag. Can be directly transfected into neurons or used to prepare AAV expressing GluA1-scFv-Halo.DepositorInsertAnti-GluA1 single chain variable fragment (scFv)
UseAAVTagsHaloTagExpressionMammalianPromoterhuman synapsinAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMR-A-6
Plasmid#138520PurposeP3dDepositorInsertT7-RNAP
UseSynthetic BiologyAvailable SinceJuly 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDM_noro_A2_lacZA
Plasmid#118819PurposeT7 RNAP-driven expression of norovirus antisense orientation toehold switches (A2) with a lacZ alpha subunit reporter.DepositorInsertNorovirus toehold switch A2
ExpressionBacterialAvailable SinceNov. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
T. aq RNA Polymerase
Plasmid#215349PurposeExpress T. aq RNA Polymerase subunits in E. coli cellsDepositorInsertRNA polymerase
Tags6x HisExpressionBacterialAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn_NES-His-rsCaMPARI-mRuby3
Plasmid#120805PurposeAAV plasmid for expressing rsCaMPARI in neurons, nucleus excludedDepositorInsertrsCaMPARI
UseAAVTagsNES-His and mRuby3Promoterhsyn (synapsin-1)Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBT138b-pro1
Plasmid#138513PurposeP3hDepositorInsertT7-RNAP
UseSynthetic BiologyAvailable SinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
Syn:eGFP-CaM-uTEV1Δ(220-242)
Plasmid#135463PurposeNeuronal expression of uFLARE protease componentDepositorInserteGFP-CaM-uTEV1Δ
UseAAVTagseGFP, V5ExpressionMammalianMutationS219V mutation improves stability and S153N impro…PromoterSynapsinAvailable SinceJan. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
SyGCaMP5G
Plasmid#162519PurposeSynaptically targeted GCaMP5GDepositorInsertGCaMP5G
ExpressionMammalianPromoterCMVAvailable SinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn1 bPAC cMyc S27A 2A tDimer
Plasmid#85398Purposehumanized photoactivated adenylyl cyclase lower dark activity, spectrum shifted 15 nm longer wavelenght with neuron-specific promoter, plus red fluorescent proteinDepositorInsertshumanized photoactivated adenylyl cyclase
red fluorescent protein
UseAAVTagscMyc TagExpressionMammalianMutationS27APromoterhuman Synapsin1 promotor and ribosomal skip seque…Available SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only