We narrowed to 15,275 results for: grn
-
Plasmid#167919PurposeLentiviral vector for expressing U6 MS2-sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pSB700 lenti gRNA Blasto_zhang2.0
Plasmid#167912PurposeLentiviral vector for expressing U6 MS2-sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA iRFP713
Plasmid#167908PurposeLentiviral vector for expressing U6 sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA(MS2)_zeo_hPDX1_promoter_guide1
Plasmid#176838PurposeTo induce human PDX1 expression by recruiting SAM complex to PDX1 promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgPDX1
ExpressionMammalianPromoterU6Available sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Bmpr2ΔEC gRNA resistant
Plasmid#163413PurposeExpresses BMPR-2ΔEC resistant to the gRNAs(#163388-90) in mammalian cellsDepositorInsertBmpr2 (Bmpr2 Mouse)
ExpressionMammalianMutationThe extracellular domain (27-150 aa) is deleted. …Available sinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Bmpr2ΔTail gRNA resistant
Plasmid#163412PurposeExpresses BMPR-2ΔTail resistant to the gRNAs(#163388-90) in mammalian cellsDepositorInsertBmpr2 (Bmpr2 Mouse)
ExpressionMammalianMutationThe C-terminal tail domain (530-1038 aa) is delet…Available sinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pM117: VEGFA array presgRNA
Plasmid#166869PurposeU6-driven expression of human VEGFA targeting array presgRNA compatible with CasRx.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHuman VEGFA targeting array presgRNA
UseCRISPRExpressionMammalianPromoterU6Available sinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAC-U63-tgRNA-nlsBFP
Plasmid#169029PurposegRNA-marker vector contain a U6:3 promoter, gRNA scaffold, and a Ubi-mTagBFP-NLS marker.DepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoterU6:3Available sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
SauCas9 EMX1-nicking sgRNA
Plasmid#169860PurposeSauCas9 nicking sgRNA for EMX1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSauCas9 EMX1-nicking sgRNA
ExpressionMammalianPromoterhuman U6 promoterAvailable sinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
SauCas9KKH CCR5-nicking sgRNA
Plasmid#169863PurposeSauCas9KKH nicking sgRNA for CCR5DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSauCas9KKH CCR5-nicking sgRNA
ExpressionMammalianPromoterhuman U6 promoterAvailable sinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNTI763 p(Z)-mCherry + UBC9 sgRNA
Plasmid#164918PurposeCEN/ARS with P(Z)-mCherry controlled by the ZEM transcription factor, also encode UBC9 sgRNADepositorInsertP(Z)-mcherry
UseCRISPRExpressionYeastPromoterP(Z), synthetic promoterAvailable sinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPLK1)-PGKpuro2ABFP-W
Plasmid#163138PurposeLentiviral gRNA plasmid targeting human PLK1 gene, co-expression of BFP tagDepositorAvailable sinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSEM254 - sgRNA mosTI neoR
Plasmid#159831PurposeSingle copy or array insertion by MosTI using split NeoR selectionDepositorInsertsgRNA mosTI neoR
ExpressionWormMutationNot applicableAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNArodA
Plasmid#149656Purposeall-in-one CRISPRi vector for targeting B. burgdorferi rodADepositorInsertdCas9, lacI, sgRNArodA
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(-10AC12)_Psyn-sgRNArodA
Plasmid#149661Purposeall-in-one CRISPRi vector for targeting B. burgdorferi rodADepositorInsertdCas9, lacI, sgRNArodA
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30(-10AC12), PsynAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gKAT7-5)-PGKpuro2ABFP-W
Plasmid#159287PurposeLentiviral vector expressing gRNA targeting KAT7 (gRNA ID. 5)DepositorInsertguide RNA targeting KAT7 (ID. 5) (KAT7 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6 promoterAvailable sinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cas9 ROSA sgRNA mCherry
Plasmid#155280PurposeLentiviral Cas9 expression, ROSA sgRNA expression, mCherry markerDepositorInsertspCas9
Available sinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-CTBP2-MGMT_1
Plasmid#136419PurposeLentiviral expression of gRNAs targeting intron 1 of human CTBP2 and intron 1 of human MGMT. Also constitutively expresses Puromycin fused to TagBFP.DepositorInsertU6_sgRNA(CTBP2)_U6_sgRNA(MGMT)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only