We narrowed to 105 results for: HBB
-
Plasmid#249134PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertHBB_IVS2-Cas9-TagBFP (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA075 Cas9-BFP-HBB_IVS2
Plasmid#249136PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron in 3' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9-TagBFP-HBB_IVS2 (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA072 Cas9-HBB_IVS2-BFP
Plasmid#249133PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron after Cas9 coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9-HBB_IVS2-TagBFP (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD685 HBB_IVS2-EnAsCas12a-BFP
Plasmid#249158PurposeOverexpression of EnAsCas12a-BFP with HBB IVS2 intron in 5' UTR with blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertHBB_IVS2-EnAsCas12a-TagBFP (HBB Synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
NG0888 pCI-TPI-PTC48-HBB
Plasmid#65802PurposeNMD reporter mRNADepositorInsertTPI (TPI1 Human)
TagsHBB (beta-globin 3'UTR for probe binding)ExpressionMammalianMutationpremature stop codon at 48PromoterCMVAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSA074 Cas9-BFP/HBB_IVS2/BFP
Plasmid#249135PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron within BFP coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9-TagBFP/HBB_IVS2/TagBFP (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD687 A2UCOE-HBB_IVS2-EnAsCas12a-BFP
Plasmid#249160PurposeOverexpression of EnAsCas12a-BFP with HBB IVS2 intron in 5' UTR with blasticidin resistance gene. Contains minimal A2UCOE and Cp36 recombination site.DepositorInsertA2UCOE-HBB_IVS2-EnAsCas12a-TagBFP (HBB Synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA076 Cas9/HBB_IVS2/Cas9-BFP
Plasmid#249137PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron within Cas9 coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9/HBB_IVS2/Cas9-TagBFP (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA128 A2UCOE-HBB_IVS2-Cas9-BFP
Plasmid#249152PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron in 5' UTR and blasticidin resistance gene. Contains minimal A2UCOE and Cp36 recombination site.DepositorInsertA2UCOE-HBB_IVS2-Cas9-TagBFP (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
MKC106_HBB(HBA1reg-HBA1-IRES-tEPOR)
Plasmid#232411PurposeAAV production plasmid for HBA+tEPOR vector from Figs. 4-6 that mediates HDR at HBB locus using HBB sg7 gRNA. HBA gene includes HBA1 exons and introns; HBA1 UTRs flank HBA+tEPOR cassette.DepositorAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-mHbb-bh1_ gRNA_1-MS2-Puro
Plasmid#192681PurposeLentiviral expression of sgRNA targeting mHbb-bh1promoter to activate mouse Hbb-bh1 transcriptionDepositorInsertMouse Hbb-bh1 activating gRNA #1 (Hbb-bh1 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSA144 HBB_IVS2-Cas9-BFP with core cHS4 insulators
Plasmid#249154PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron in 5' UTR and blasticidin resistance gene. Flanked by cHS4 core insulators. Contains Cp36 recombination site.DepositorInsertHBB_IVS2-Cas9-TagBFP with core cHS4 insulators (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD292 PPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-BFP
Plasmid#249156PurposeOverexpression of PPH-T2A-dCas9-NFZ-P2A-BFP with HBB IVS2 intron in PPH coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertPPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-mTagBFP2 (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
MLM3739
Plasmid#49959PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene for use as a controlDepositorInsert3x Flag Tet1CDmut HB-4 (HBB Human)
UseTALENTags3x FLAGMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
MLM3747
Plasmid#49965PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene for use as a controlDepositorInsert3x Flag Tet1CDmut HB-6 (HBB Human)
UseTALENTags3x FLAGMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
MLM3743
Plasmid#49962PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene for use as a controlDepositorInsert3x Flag Tet1CDmut HB-5 (HBB Human)
UseTALENTags3x FLAGMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
MLM3727
Plasmid#49961PurposeExpresses a 3x Flag TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceJan. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
VC388
Plasmid#49958PurposeExpresses a 3x Flag TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only