We narrowed to 95 results for: HBB
-
Plasmid#65802PurposeNMD reporter mRNADepositorInsertTPI (TPI1 Human)
UseTagsHBB (beta-globin 3'UTR for probe binding)ExpressionMammalianMutationpremature stop codon at 48PromoterCMVAvailable sinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
MKC106_HBB(HBA1reg-HBA1-IRES-tEPOR)
Plasmid#232411PurposeAAV production plasmid for HBA+tEPOR vector from Figs. 4-6 that mediates HDR at HBB locus using HBB sg7 gRNA. HBA gene includes HBA1 exons and introns; HBA1 UTRs flank HBA+tEPOR cassette.DepositorInsertHemoglobin Subunit Alpha 1 (HBA1 Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-mHbb-bh1_ gRNA_1-MS2-Puro
Plasmid#192681PurposeLentiviral expression of sgRNA targeting mHbb-bh1promoter to activate mouse Hbb-bh1 transcriptionDepositorInsertMouse Hbb-bh1 activating gRNA #1 (Hbb-bh1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (Hbb Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
MLM3739
Plasmid#49959PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene for use as a controlDepositorInsert3x Flag Tet1CDmut HB-4 (HBB Human)
UseTALENTags3x FLAGExpressionMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable sinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
MLM3747
Plasmid#49965PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene for use as a controlDepositorInsert3x Flag Tet1CDmut HB-6 (HBB Human)
UseTALENTags3x FLAGExpressionMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable sinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
MLM3743
Plasmid#49962PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene for use as a controlDepositorInsert3x Flag Tet1CDmut HB-5 (HBB Human)
UseTALENTags3x FLAGExpressionMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable sinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
MLM3727
Plasmid#49961PurposeExpresses a 3x Flag TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorInsert3x Flag Tet1CD HB-5 (HBB Human)
UseTALENTags3x FLAGExpressionMutationPromoterEF1aAvailable sinceJan. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
VC388
Plasmid#49958PurposeExpresses a 3x Flag TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorInsert3x Flag Tet1CD HB-4 (HBB Human)
UseTALENTags3x FLAGExpressionMutationPromoterEF1aAvailable sinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1246
Plasmid#49960PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorInsertTet1CD HB-5 (HBB Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1238
Plasmid#49957PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorInsertTet1CD HB-4 (HBB Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
MLM3733
Plasmid#49964PurposeExpresses a 3x Flag TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorInsert3x Flag Tet1CD HB-6 (HBB Human)
UseTALENTags3x FLAGExpressionMutationPromoterEF1aAvailable sinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1261
Plasmid#49963PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorInsertTet1CD HB-6 (HBB Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1290
Plasmid#49968PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorInsertTet1CD HB-9 (HBB Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
JA1252
Plasmid#49956PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorInsertTet1CD HB-3 (HBB Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1280
Plasmid#49969PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorInsertTet1CD HB-10 (HBB Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1272
Plasmid#49967PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorInsertTet1CD HB-8 (HBB Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1266
Plasmid#49966PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorInsertTet1CD HB-7 (HBB Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
JA1229
Plasmid#49955PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorInsertTet1CD HB-2 (HBB Human)
UseTALENTagsExpressionMutationPromoterEF1aAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only