We narrowed to 6,754 results for: hwa
-
Plasmid#173012PurposeFor light regulated release of transferrin receptor (TfR) from the endoplasmic reticulum. Driven by CMV promoter. Fused to oxidation resistant version of GFP (moxGFP).DepositorInsertTfR-moxGFP-DHFR
TagsDHFR and moxGFPExpressionMammalianPromoterCMVAvailable SinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
2xFKBP-smFP(myc)-KDEL
Plasmid#173021PurposeFKBP anchor for retaining DHFR-fused cargoes in the ER in the presence of zapalog. Encodes ER retrieval motif (KDEL) at C-terminus of spaghetti monster FP (myc, non-fluorescent). IRES following ORF.DepositorInsert2xFKBP-smFP(myc)-KDEL
TagsFKBP and smFP(myc) non-fluorescentExpressionMammalianAvailable SinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
MK969
Plasmid#71432PurposeThe pAK plasmid expresses GFP driven by a T7 promoterDepositorInsertgfp
PromoterT7Available SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR_D17_hrGFP
Plasmid#84616PurposeHR donor to integrate UAS1B8TEF(136)-hrGFP-CYC1t into D17 locusDepositorInserthrGFP
UseSynthetic BiologyExpressionYeastPromoterUAS1B8-TEF(136)Available SinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR_MFE1_hrGFP
Plasmid#84617PurposeHR donor to integrate UAS1B8TEF(136)-hrGFP-CYC1t into MFE1 locusDepositorInserthrGFP
UseSynthetic BiologyExpressionYeastPromoterUAS1B8-TEF(136)Available SinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR_AXP_hrGFP
Plasmid#84613PurposeHR donor to integrate UAS1B8TEF(136)-hrGFP-CYC1t into AXP locusDepositorInserthrGFP
UseSynthetic BiologyExpressionYeastPromoterUAS1B8-TEF(136)Available SinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR_XPR2_hrGFP
Plasmid#84614PurposeHR donor to integrate UAS1B8TEF(136)-hrGFP-CYC1t into XPR2 locusDepositorInserthrGFP
UseSynthetic BiologyExpressionYeastPromoterUAS1B8-TEF(136)Available SinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR_A08_hrGFP
Plasmid#84615PurposeHR donor to integrate UAS1B8TEF(136)-hrGFP-CYC1t into A08 locusDepositorInserthrGFP
UseSynthetic BiologyExpressionYeastPromoterUAS1B8-TEF(136)Available SinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRyl_D17
Plasmid#84611PurposeIntroduces DSB at D17 locus in Y. lipolyticaDepositorInsertCas9
UseCRISPR and Synthetic BiologyExpressionYeastPromoterUAS1B8-TEF(136)Available SinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRyl_MFE1
Plasmid#84612PurposeIntroduces DSB at MFE1 locus in Y. lipolyticaDepositorInsertCas9
UseCRISPR and Synthetic BiologyExpressionYeastPromoterUAS1B8-TEF(136)Available SinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRyl_XPR2
Plasmid#84609PurposeIntroduces DSB at XPR2 locus in Y. lipolyticaDepositorInsertCas9
UseCRISPR and Synthetic BiologyExpressionYeastPromoterUAS1B8-TEF(136)Available SinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRyl_AXP
Plasmid#84608PurposeIntroduces DSB at AXP locus in Y. lipolyticaDepositorInsertCas9
UseCRISPR and Synthetic BiologyExpressionYeastPromoterUAS1B8-TEF(136)Available SinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRyl_A08
Plasmid#84610PurposeIntroduces DSB at A08 locus in Y. lipolyticaDepositorInsertCas9
UseCRISPR and Synthetic BiologyExpressionYeastPromoterUAS1B8-TEF(136)Available SinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pF-N-HiBiT-template
Plasmid#200882Purposetemplate for N-terminal HiBIT-taggingDepositorInsertHiBIT-linker
ExpressionMammalianMutationWTAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
prhaBAD-anti-rabbit-Nb-Hia5
Plasmid#239627PurposeRhamnose inducible expression plasmid for anti-rabbit nanobody fusion to Hia5 DNA adenine methyltransferaseDepositorInsertHia5
Tags6HIS, MBP, TEV, and anti-Rabbit NanobodyExpressionBacterialMutationCodon optimized for bacterial expressionPromoterrhaBADAvailable SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
HaloTag-WDR5
Plasmid#200880PurposeMammalian expression of human WDR5 with N-terminal HaloTag fusionDepositorAvailable SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
WDR5-HaloTag
Plasmid#200881PurposeMammalian expression of human WDR5 with C-terminal HaloTag fusionDepositorAvailable SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNIC28-HiBIT-WDR5
Plasmid#200883PurposeBacterial expression of N-terminal HiBIT-tagged human WDR5 proteinDepositorAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only