We narrowed to 481 results for: lenticrispr
-
Plasmid#244865PurposeKnockout of human OMA1DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLentiCRISPR ATP23 sg1
Plasmid#244847PurposeKnockout of human ATP23DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR ATP23 sg2
Plasmid#244848PurposeKnockout of human ATP23DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgCBS-1
Plasmid#230081PurposeCrispr knock out human CBS geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgCBS-2
Plasmid#230082PurposeCrispr knock out human CBS geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgL2HGDH-1
Plasmid#230083PurposeCrispr knock out human L2HGDH geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgL2HGDH-2
Plasmid#230084PurposeCrispr knock out human L2HGDH geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgL2HGDH-3
Plasmid#230085PurposeCrispr knock out human L2HGDH geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1-49535-sgFmr1_CGG5-2
Plasmid#222964PurposeTargeting FMR1 5' UTR for CGG deletionDepositorInsertFMR1 sgRNA (FMR1 Human)
UseCRISPRAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCriprV2-sgRNA-PER1-#2
Plasmid#189988PurposeLentiviral Cas9/sgRNA vector targeting C-terminus of hPER1, works with Addgene 189979-189982DepositorInsertPeriod1 (PER1 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-XYLT2-sgRNA
Plasmid#154862PurposeLentiviral expression of Cas9 and sgRNA targeting XYLT2DepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOT_2 - lenti-EFS-tNGFR-2A-puro
Plasmid#181971PurposeExpresses human truncated NGFR linked to puromycin resistance via P2A for lentiviral delivery.DepositorAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP FL
Plasmid#179550Purposeencodes S. pyogenes dCas9 with c-terminal fusion of full length human CBP driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of full length human CBP (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOT_1 - lenti-EFS-LTBR-2A-puro
Plasmid#181970PurposeExpresses human LTBR linked to puromycin resistance via P2A for lentiviral delivery.DepositorInsertLTBR (LTBR Human)
UseLentiviralAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCrisprV2 sgRNA hCRY1 c-term
Plasmid#179453PurposeLentiviral Crispr/Cas9 plasmid targeting hCRY1 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human CRY1
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-GCN5 FL
Plasmid#179552Purposeencodes S. pyogenes dCas9 with c-terminal fusion of full length human GCN5 driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of full length human GCN5 (KAT2A Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
lenti U6-sgRNA-acRNA SYN-dCas9-P2A-EGFP
Plasmid#159086PurposeExpresses dCas9-P2A-EGFP driven by human SYN promoter and empty CRISPR Display sgRNA/accessory RNA from U6 promoter.DepositorInsertempty crRNA-acRNA backbone, dCas9-P2A-EGFP
UseCRISPR and LentiviralTagsEGFP and FLAGExpressionMammalianPromoterhSYN, U6Available SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc
Plasmid#208382PurposeDerived from LentiCRISPRV2 by replacing Cas9 with Cre recombinase and puromycin resistance with GpNLuc. Contains a stuffer sequence for cloning of sgRNA of interest, as per LentiCRISPRV2.DepositorTypeEmpty backboneUseLentiviral and LuciferaseExpressionMammalianMutationWTAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
KAT5 sgRNA1
Plasmid#138187Purpose3rd generation lentiviral gRNA plasmid targeting human KAT5DepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only