We narrowed to 43,969 results for: gats
-
Plasmid#146182PurposeInsect Expression of CATDepositorInsertCAT
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-CAT-PTC72_E
Plasmid#146185PurposeInsect Expression of CAT-PTC72DepositorInsertCAT-PTC72
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-cxadr
Plasmid#192734PurposeGateway entry vector encoding zebrafish cxadrDepositorAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-hspa13
Plasmid#192730PurposeGateway entry vector encoding zebrafish hspa13DepositorAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-nrip1a
Plasmid#192731PurposeGateway entry vector encoding zebrafish nrip1aDepositorInsertnrip1a (LOC796407 Zebrafish)
UseGateway entry vectorMutationE662Q; S895P; H967QPromoterNoneAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-dyrk1aa
Plasmid#192741PurposeGateway entry vector encoding zebrafish dyrk1aaDepositorAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-erg
Plasmid#192728PurposeGateway entry vector encoding zebrafish ergDepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj6
Plasmid#192725PurposeGateway entry vector encoding zebrafish kcnj6DepositorInsertkcnj6 (kcnj6 Zebrafish)
UseGateway entry vectorMutation5' insertion of ATGGCCAAGCTGACAGAATCC, ident…PromoterNoneAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
p667-UBC-hcRed-V5_IDG-K
Plasmid#135239PurposeGateway destination clone of hcRed (as control) tagged with C-terminal V5 for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInserthcRed-V5
UseLentiviral; Gateway destinationTagsV5ExpressionMammalianPromoterUbiquitinAvailable SinceJan. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
p663-UBC-V5-eGFP_IDG-K
Plasmid#135265PurposeGateway destination clone of eGFP (as control) tagged with N-terminal V5 for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertV5-eGFP
UseLentiviral; Gateway destinationTagsV5ExpressionMammalianPromoterUbiquitinAvailable SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
R777-E337 Hs.STK3
Plasmid#70621PurposeGateway ORF clone of human STK3 [NM_006281.3] with stop codon (for native or N-terminal fusions)DepositorInsertSTK3 (STK3 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E338 Hs.STK3-nostop
Plasmid#70622PurposeGateway ORF clone of human STK3 [NM_006281.3] without stop codon (for C-terminal fusions)DepositorInsertSTK3 (STK3 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E300 Hs.RPS6KB2-nostop
Plasmid#70584PurposeGateway ORF clone of human RPS6KB2 [NM_003952.2] without stop codon (for C-terminal fusions)DepositorInsertRPS6KB2 (RPS6KB2 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E278 Hs.RHOA-nostop
Plasmid#70562PurposeGateway ORF clone of human RHOA [NM_001664.2] without stop codon (for C-terminal fusions)DepositorInsertRHOA (RHOA Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E058 Hs.EIF4EBP2-nostop
Plasmid#70342PurposeGateway ORF clone of human EIF4EBP2 [NM_004096.4] without stop codon (for C-terminal fusions)DepositorInsertEIF4EBP2 (EIF4EBP2 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E060 Hs.EIF4EBP3-nostop
Plasmid#70344PurposeGateway ORF clone of human EIF4EBP3 [NM_003732.2] without stop codon (for C-terminal fusions)DepositorInsertEIF4EBP3 (EIF4EBP3 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E024 Hs.CDK4-nostop
Plasmid#70308PurposeGateway ORF clone of human CDK4 [NM_000075.3] without stop codon (for C-terminal fusions)DepositorInsertCDK4 (CDK4 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCVL TAL(Nd154C63) T7 Age-Xho/Xba-Sal linkers
Plasmid#50624PurposepTAL plasmid for cloning of megaTALs or other TAL-fusions and expression in mammalian cells. RVDs are cloned between Age-Xho sites and meganuclease/fusion is cloned between Xba-Sal sites.DepositorTypeEmpty backboneUseMrna productionPromoterT7Available SinceJan. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
TALEN_C18
Plasmid#47974PurposeGolden Gate Compatible TALEN Construct site specific modification of genome, shortened C Terminus, Codon Optimized FokIDepositorInsertTranscription Activator Like Effector Nuclease
UseTALENExpressionMammalianMutationShortened C-Terminus,Codon Optimized FokI Endonuc…PromoterCMVAvailable SinceDec. 12, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEZY45
Plasmid#18704PurposepJG4-5 converted Gateway Destination vector for yeast two-hybrid prey vectorDepositorTypeEmpty backboneUseTwo-hybrid prey vectorExpressionYeastPromoterGAL1Available SinceJuly 26, 2008AvailabilityAcademic Institutions and Nonprofits only