We narrowed to 4,185 results for: PRS
-
Plasmid#213555PurposeLentiviral vector for stable expression of N273K Parkin, internally tagged with mKO2DepositorInsertParkin (PRKN Human)
UseLentiviralExpressionMammalianMutationN273K mutation in ParkinPromoterEF1aAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLv-EF1a-Parkin(W403A)-A92mKO2
Plasmid#213558PurposeLentiviral vector for stable expression of W403A Parkin, internally tagged with mKO2DepositorInsertParkin (PRKN Human)
UseLentiviralExpressionMammalianMutationW403A mutation in ParkinPromoterEF1aAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSN072
Plasmid#166730PurposeSingle copy yeast plasmid expressing DNase-dead dLbCas12a E925A fused to NLS, Mxi1 and NLS, codon optimized for Saccharomyces cerevisiaeDepositorInsertdCas12a-NLS-Mxi1-NLS
UseCRISPRTagsMxi1 and SV40 NLSExpressionYeastMutationE925APromoterS. cerevisiae TEF1Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHBDuet139
Plasmid#121913PurposeCharge-Introduced NpuDnaB mini-inteinDepositorInsertCI-NpuDnaBΔ290 intein
TagsGB1 and His6-GB1ExpressionBacterialMutationDeletion of 290-residue endonuclease domain, I53K…PromoterT7Available SinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBDuet140
Plasmid#121914PurposeOrthogonal NpuDnaB mini-intein inteinDepositorInsertOth-NpuDnaBΔ290 intein
TagsGB1 and His6-GB1ExpressionBacterialMutationDeletion of 290-residue endonuclease domain, I53K…PromoterT7Available SinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pCuHA-ATG13[3SD](426)
Plasmid#122077PurposeExpressing HA-ATG13[3SD]DepositorInsertATG13
Tags3HAExpressionYeastMutationSerine 646 to aspartic acid; Serine 649 to aspart…Available SinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGFP-ATG13[3SD](315)
Plasmid#122074PurposeExpressing GFP-Atg13[3SD]DepositorInsertATG13
TagsGFPExpressionYeastMutationSerine 646 to aspartic acid; Serine 649 to aspart…Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Hsh155 T178A R181A R182A R186A (N4A)
Plasmid#111940PurposeThis is a shuffle plasmid containing the HSH155 gene and the surrounding genomic regions. It bears a TRP marker for shuffle into a HSH155 deletion strain. It has the T178A R181A R182A R186A mutationDepositorInsertHsh155 T178A R181A R182A R186A (N4A)
ExpressionBacterial and YeastMutationT178A R181A R182A R186AAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
Hsh155 Q773A R775A R776A Q778A (C4A)
Plasmid#111946PurposeThis is a shuffle plasmid containing the HSH155 gene and the surrounding genomic regions. It bears a TRP marker for shuffle into a HSH155 deletion strain. It has the Q773A R775A R776A Q778A mutationDepositorInsertHsh155 Q773A R775A R776A Q778A (C4A)
ExpressionBacterial and YeastMutationQ773A R775A R776A Q778AAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
PRPS2 gRNA (BRDN0001145436)
Plasmid#78008Purpose3rd generation lentiviral gRNA plasmid targeting human PRPS2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRPS2 gRNA (BRDN0001146576)
Plasmid#78007Purpose3rd generation lentiviral gRNA plasmid targeting human PRPS2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pWZ414-F33
Plasmid#23068DepositorInsertyeast Histone H3-2 and Histone H4-2
ExpressionYeastMutationHistone H4 changed Lysine 5 to Glutamine H4 K5QAvailable SinceMarch 3, 2010AvailabilityAcademic Institutions and Nonprofits only -
pWZ414-F47
Plasmid#23071DepositorInsertyeast Histone H3-2 and Histone H4-2
ExpressionYeastMutationHistone H4 changed Lysines 8 and 16 to Glutamines…Available SinceFeb. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pWZ414-F49
Plasmid#23073DepositorInsertyeast Histone H3-2 and Histone H4-2
ExpressionYeastMutationHistone H4 changed Lysines 8 and 16 to Arginine, …Available SinceFeb. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pWZ414-F51
Plasmid#23075DepositorInsertyeast Histone H3-2 and Histone H4-2
ExpressionYeastMutationHistone H4 changed Lysines 5 and 12 to Glutamine,…Available SinceFeb. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pWZ414-F52
Plasmid#23076DepositorInsertyeast Histone H3-2 and Histone H4-2
ExpressionYeastMutationHistone H4 changed Lysines 5 and 12 to Arginines,…Available SinceFeb. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pWZ414-F36
Plasmid#23069DepositorInsertyeast Histone H3-2 and Histone H4-2
ExpressionYeastMutationHistone H3 changed Lysine 14 to Glycine, H3 K14GAvailable SinceFeb. 5, 2010AvailabilityAcademic Institutions and Nonprofits only -
pWZ414-F43
Plasmid#23070DepositorInsertyeast Histone H3-2 and Histone H4-2
ExpressionYeastMutationHistone H3 changed Lysine 14 to Arginine, H3 K14RAvailable SinceFeb. 5, 2010AvailabilityAcademic Institutions and Nonprofits only