We narrowed to 7,609 results for: Pol
-
Plasmid#221075PurposeSEMPER plasmid for expression of msfGFP[r5M] and mEBFP2 in ratios dictated by the trinucleotide TIS. Relative ORF expression is characterized in publicationDepositorInsertACC-msfGFP[r5M]_ACC-mEBFP2_IRES-mCherry
ExpressionMammalianPromoterCMVAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
ULK1-Halo HRD
Plasmid#207548PurposeHomologous recombination donor to integrate a 3xFLAG-HaloTag at the C-terminus of the endogenous ULK1 locus in human cellsDepositorInsertHaloTag followed by a PolyA signal and PuroR cassette flanked by human ULK1 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFBOH-LIC_DDB1:1-1140
Plasmid#210886PurposeInsect expression of full-length human DDB1. Untagged.DepositorAvailable SinceMarch 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pegRNA entry vector - pUC19-U6-[BsmBI_entry]-term (MNW320)
Plasmid#208977PurposeEntry vector for human U6 promoter driven SpCas9-based pegRNAs, comprised of hU6-[BsmBI]-terminator (spacer and RTT/PBS oligos must be cloned in)DepositorInsertpUC19-U6-[BsmBI]-term (pegRNA_entry_vector)
UseCRISPRTagsBPNLSExpressionMammalianPromoterhuman U6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-Hyg-Dest-mCherry-PAR-6B
Plasmid#194908PurposeTo generate mCherry-PAR-6B (mouse) expressing stable cell lines with piggybac transposase co-expression and hygromycin selections.DepositorInsertPAR-6B (Pard6b Mouse)
UseMouse TargetingTagsmCherryExpressionMammalianMutation39 C to G, silent mutationAvailable SinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-AcGFP-Cdk5rap2-CTD
Plasmid#196853PurposeExpression of the centrosome targeting carboxy-terminal domain (CTD) of Cdk5rap2 fused to AcGFP. Used to displace endogenous Cdk5rap2 from centrosomes.DepositorInsertAcGFP-Cdk5rap2-CTD (Cdk5rap2 Rat)
ExpressionMammalianMutationNone (wt)PromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-td-mCherry-Cdk5rap2-CTD
Plasmid#196854PurposeExpression of the centrosome targeting carboxy-terminal domain (CTD) of Cdk5rap2 fused to tandem (td)-mCherry. Used to displace endogenous Cdk5rap2 from centrosomes.DepositorInserttd-mCherry-Cdk5rap2-CTD (Cdk5rap2 Discosoma sp.)
ExpressionMammalianMutationNone (wt)PromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
AV15_pCAG.Cas9.gRNA.S1
Plasmid#199259PurposeExpression construct encoding SpCas9 nuclease and an AAVS1-targeting guide RNADepositorInsertsSpCas9 nuclease
AAVS1-targeting gRNA
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterCAG promoter and RNA polymerase III promoter for …Available SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P-1-eIF4E K119A
Plasmid#199440PurposeBacterial expression plasmids for production of recombinant GST-eIF4E K119ADepositorInsert1977 (EIF4E Human)
TagsGST-fusion proteinExpressionBacterialMutationchanged lysine 119 to alanineAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-LivePAR(R163A)-Hygro
Plasmid#187609PurposeEGFP fused to the C-terminus of a WWE domain containing the mutation Arg163Ala & a hygromycin resistance cassette.DepositorInsertLivePAR(R163A)
UseLentiviralTagsEGFPExpressionMammalianMutationR163A mutation in the WWE DomainPromoterEF1AAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pMH-HT_ygiF-CHAD
Plasmid#127793PurposeExpresses the CHAD domain of ygiF in E. coli cellsDepositorInsertygiF-CHAD (ygiF Escherichia coli)
Tags6xHis tag + TEV cleavage siteExpressionBacterialMutationN-terminal TTM domain of ygiF (residues 201-433)Available SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
CAG-RORb2-IRES-GFPd2
Plasmid#73998PurposePlasmid expressing RORb2-IRES-GFPd2DepositorAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB319
Plasmid#68647PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantPromoterCauliflower mosaic virus 35S promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB219
Plasmid#68610PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantPromoterCauliflower mosaic virus 35S promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
ptdEos-CLC
Plasmid#38009DepositorInsertsExpressionBacterial and MammalianPromoterCMVAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET41s-GST-ATF6a-AD
Plasmid#64774Purposebacterial expression of GST-tagged ATF6 (1-150)DepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SEMPER-mARG_ACC-gvpA_ACC-gvpNJKFGW-EmGFP_IRES-mCherry
Plasmid#221080PurposeSEMPER plasmid for expression of gas vesicles using mammalian acoustic reporter genes (mARGs)DepositorInsertACC-gvpA_ACC-gvpNJKFGW-EmGFP_IRES-mCherry
ExpressionMammalianPromoterCMVAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGM238
Plasmid#220178PurposeExpresses exogenous ribosomal-binding domain mutant NAC complex members (K78E NACA and K43E BTF3)DepositorUseLentiviralTags3xFLAG (NACA); 6xHis (BTF3)MutationK78E (NACA) + K43B (BTF3)Available SinceJune 7, 2024AvailabilityAcademic Institutions and Nonprofits only