We narrowed to 5,205 results for: Mos;
-
Plasmid#120404Purposeenables eukaryotic expression of human plasma fibronectin in which the first O-glycosylation site was mutated from threonine to serineDepositorInsertFibronectin (FN1 Human)
ExpressionMammalianMutationContaining complete variable region with a mutati…PromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-mutated V2 O-Glycosylation site
Plasmid#120405Purposeenables eukaryotic expression of human plasma fibronectin in which the second O-glycosylation site was mutated from threonine to serineDepositorInsertFibronectin (FN1 Human)
ExpressionMammalianMutationContains complete variable region with a mutation…PromoterCMVAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (FL-based no force control)
Plasmid#118722PurposeThe donor (YPet(short)) only control for the no force control of the FL-based human desmoplakin II tension sensor provides the donor only lifetime used in lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-FL-mCherry(Y72L)] (DSP Human)
UseRetroviralTagsYPet(short)-FL-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y72L mutation in mCherry…PromoterCMVAvailable SinceDec. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II acceptor only control (F40-based no force control)
Plasmid#118720PurposeThe acceptor (mCherry) only control for the no force control of the F40-based human desmoplakin II tension sensor can be co-expressed with the donor only control to determine intermolecular FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)(Y67G)-F40-mCherry] (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y67G mutation in YPet(sh…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno FT
Plasmid#101824PurposeAdenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3DepositorUseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/T0-Flag-CIP2A
Plasmid#222623Purposemammalian expression vector of Flag-tagged CIP2ADepositorAvailable SinceJuly 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pB-EF1a-FastFUCCI-IRES-3xnls-mTagBFP2 (JDW 1511)
Plasmid#242599PurposeA PiggyBac expression vector containing the human EF1a promoter driving FastFUCCI to label cell cycle state followed by an IRES-3xnls-mTagBFP2.DepositorInsertmKO2-hCDT1(30-120) T2A mAG-hGEM(1-110) (EEF1A1 Human)
ExpressionMammalianPromoterhuman EF1aAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-Flag-SPRTN-wt
Plasmid#110214PurposeExpression in mammalian cells of full-length wild-type SPRTN protein with a Flag-tag at N-terminus.DepositorAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZB246-T7-T+
Plasmid#250903PurposeExpresses N-terminal His-tag thermally stabilized T7 RNAP under a lac-inducible promoter on Kanamycin Resistance BackboneDepositorInsertThermally Stable T7 RNA Polymerase
Tags6xHisExpressionBacterialMutationArginine 31 to Aspartic Acid, Alanine 61 to Argin…PromoterpT5-lacUVAvailable SinceFeb. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHIV-NAT-FLAG-CIP2A FL (sg2R)
Plasmid#222624PurposeLentiviral vector that expresses Flag-tagged sgRNA resistant CIP2A in mammalian cellsDepositorInsertCIP2A (CIP2A Human)
UseLentiviralTagsFlagExpressionMammalianPromoterEF-1-alpha promoterAvailable SinceJuly 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
PIG-MycT58A
Plasmid#177648PurposeExpression of mouse Myc with T58A point mutationDepositorInsertMyc-T58A (Myc Mouse)
UseRetroviralTagsGFP and IRESExpressionMammalianMutationT58A point mutationAvailable SinceFeb. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCag SE (Self-excising) FlpO-2A-Cre EV
Plasmid#130986Purposeepisomal expression of FlpO and Cre recombinases, self excisingDepositorInsertFlpO-2A-Cre
UseCre/Lox and Unspecified; Episomal expression vect…ExpressionMammalianMutationprotamine intron added to FlpO to prevent bacteri…PromoterCMV/Chick β-actin (CAG)Available SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TAF15 Stop
Plasmid#84895PurposeDONOR vector for Gateway cloning of TAF15DepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIG-Myc
Plasmid#177650PurposeExpression of wild-type mouse MycDepositorAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pME-V5-mClover-KRAS4A-G12D (JDW 813)
Plasmid#242567PurposeGateway middle entry clone containing an mClover3 fused human KRAS4A G12D.DepositorInsertKRAS4A-G12D (KRAS Human)
UseGateway subcloningAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform2_Flag
Plasmid#191999PurposeLentiviral vector to generate flag-tagged LYSET(TMEM251)-isoform2 stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform1_untagged-Puro
Plasmid#192001PurposeLentiviral vector to generate LYSET(TMEM251)-isoform1 stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28 His-MBP-TEV-BAP-Human BCKDK
Plasmid#232116PurposeFor bacterial expression of Human BCKDK (AA31–412, missing precursor peptide) with an N-terminal biotin acceptor peptide and a cleavable His-MBP purification tag.DepositorInsertBCKDK (BCKDK Human)
Tags6 x His, Biotin acceptor peptide (BAP), Maltose-B…ExpressionBacterialPromoterT7 PromoterAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin I donor only control (F40-based tension sensor)
Plasmid#119188PurposeThe donor (mTFP1) only control for the F40-based human desmoplakin I tension sensor can be used for bleedthrough calibration and provides the donor only lifetime to determine FRET efficiency.DepositorInserthuman Desmoplakin I-[mTFP1-F40-mEYFP(Y67G)] (internal-1945) (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterTCEAvailable SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only