We narrowed to 11,874 results for: 110
-
Plasmid#110640PurposeRetroviral expression of SFXN5 in mammalian cellsDepositorAvailable SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only
-
ABCB8 (ABCB8A-c016)
Plasmid#110266PurposeBaculovirus expression for structure determination; may not be full ORFDepositorAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1alpha-HA-TFAP4
Plasmid#110158PurposeLentiviral vector for expression of human TFAP4 in mammalian cellsDepositorInsertTFAP4 (transcription factor AP-4) (TFAP4 Human)
UseLentiviralTagsHAExpressionMammalianPromoterCMVAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_KPNB1_HEAT
Plasmid#110017PurposeProtein expression and purification of KPNB1_HEATDepositorInsertKPNB1_HEAT (KPNB1 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNIC-ZB-SPRTN-E112A-FL
Plasmid#110218PurposeExpression in E. coli of full-length SPRTN protein carrying E112A mutation, a catalytically-dead mutant, with His and ZB tags at N-terminus.DepositorInsertSPRTN (SPRTN Human)
TagsHis6 and ZBExpressionBacterialMutationE112A, P296L (see depositor comments below)Available SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBTK401
Plasmid#110597PurposeBTK Type 8 Bacterial origin (broad-host-range) for golden gate assemblyDepositorInsertmRFP dropout (RSF1010 origin)
UseSynthetic BiologyAvailable SinceFeb. 14, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
KG#371
Plasmid#110882PurposeExpresses the lysosome marker CTNS-1-mCherry cDNA in a subset of ventral cord cholinergic motor neuronsDepositorInsertsunc-129 promoter
CTNS-1a-mCherry cDNA
unc-54 3' control region with 1 intron just upstream and 1 intron in control region
Tagsintron-mCherryExpressionBacterialAvailable SinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HF1RA-P2A-Puro
Plasmid#110853PurposeLentiviral vector for constitutive expression of Cas9-HF1RA in mammalian cells (codon optimized)DepositorInsertCas9-HF1RA
UseLentiviralTagsFLAGMutationR661A, Q695A, Q926A, and NLS sequence at the N-te…PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_PLAT_Trypsin
Plasmid#110039PurposeProtein expression and purification of PLAT_TrypsinDepositorInsertPLAT_Trypsin (PLAT Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
B. fragilis 16S toehold switch sensor
Plasmid#110696PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP outputDepositorInsertB. fragilis 16S toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-Hel25E WT
Plasmid#110123PurposeExpresses Flag-tagged D. melanogaster Hel25EDepositorAvailable SinceOct. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-Hel25E K91N
Plasmid#110121PurposeExpresses Flag-tagged D. melanogaster Hel25E with K91N mutation that greatly reduces helicase activityDepositorInsertHel25E (Hel25E Fly)
TagsFlagExpressionInsectMutationK91N mutationPromoterMetallothionein Promoter (pMT)Available SinceSept. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-Hel25E D193E
Plasmid#110120PurposeExpresses Flag-tagged D. melanogaster Hel25E with D193E mutation that greatly reduces ATP binding affinityDepositorInsertHel25E (Hel25E Fly)
TagsFlagExpressionInsectMutationD193E mutationPromoterMetallothionein Promoter (pMT)Available SinceSept. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
KG#65
Plasmid#110933PurposeExpresses proteins in cholinergic neurons in the ventral nerve cord of C. elegansDepositorInsertsunc-17 beta promoter
unc-54 3' control region
ExpressionBacterialAvailable SinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMINTC3GH (Apr)
Plasmid#110078PurposeAnalogous to pMINTNH3 but with a C-terminal 3C cleavage site and a GFP-His10 tag fusion.DepositorTypeEmpty backboneTags3C cleavage site - GFP - His10 TagExpressionBacterialAvailable SinceMay 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBTK601
Plasmid#110607PurposeBTK assembled plasmid - encodes Cas9 with no targeting sgRNA (used with suicide plasmid for broad-host-range genome alteration)DepositorInsertCas9
UseSynthetic BiologyAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR 3UTR
Plasmid#110412PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_PFN2_Profilin
Plasmid#110007PurposeProtein expression and purification of PFN2_ProfilinDepositorInsertPFN2_Profilin (PFN2 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
SOAP-COMP-blac-flag-his
Plasmid#110997PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertsecreted ookinete adhesive protein (SOAP) (PF3D7_1404300 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
CTRP-COMP-blac-flag-his
Plasmid#110994PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertcircumsporozoite- and TRAP-related protein (CTRP) (CTRP Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only