We narrowed to 4,453 results for: gca
-
Plasmid#156181PurposeCMV-driven expression of sgRNA-resistant SLC38A2 N82A mutant cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterCMVAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pInducer20_SLC38A2_N82A
Plasmid#156183PurposeDox-inducible expression of sgRNA-resistant SLC38A2 N82A mutant cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterTREAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1270 - pAAV Rosa26 gRNA A+B EF1a EGFP
Plasmid#113156PurposeAn AAV vector that expresses guide RNAs targeting rat Rosa26 and expresses EGFP reporterDepositorInsertTwo gRNAs for rat Rosa26
UseAAV and CRISPRExpressionMammalianPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shGDF11 #1
Plasmid#83083PurposeLentiviral shRNA vector for inducible knockdown of human GDF11 (cross reacts with mouse Gdf11)DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
TAF1 gRNA (BRDN0001147230)
Plasmid#77869Purpose3rd generation lentiviral gRNA plasmid targeting human TAF1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
TTN gRNA (BRDN0001148405)
Plasmid#76852Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001146399)
Plasmid#76853Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
lenti-hygro-sgMETTL1-6
Plasmid#254417PurposeMammalian expression plasmid encoding an sgRNA targeting human METTL1.DepositorAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pscAAV-KIKO-U6-gTgfbr2-p2a-mCherry-STOPpA-400
Plasmid#249131Purposeall-in-one HDRT-based knockin-knockout (KIKO) design to insert mCherry (=knockin) at gTgfbr2 cut site, disrupting Osmr expression (=knockout)DepositorInsertgTgfbr2, mCherry (Tgfbr2 Mouse, Synthetic)
UseAAVAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-Letm1shRNA-hPGK-Puro
Plasmid#215362PurposeExpresses a rat Letm1 specific shRNADepositorInsertLetm1 shRNA Target sequence (Letm1 Rat)
UseLentiviralAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-Letm1shRNA-hPGK-mTagBFP2
Plasmid#215363PurposeExpresses a rat Letm1 specific shRNA and a BFP under a separate hPGK promoterDepositorAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-Letm1shRNA-hPGK-miRFPnano
Plasmid#215365PurposeExpresses a rat Letm1 specific shRNA and miRFPnano under a separate hPGK promoterDepositorAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgETS1-1
Plasmid#251685PurposegRNA to knock out ETS1 in mammalian cellsDepositorInsertETS1 ETS proto-oncogene 1, transcription factor (ETS1 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLCV2-CDK13(hU6-sg2-mU6-sg3)-Blast
Plasmid#208348PurposepLentiCRISPRv2-Blast backbone with two separate sgRNAs against CDK13DepositorArticleAvailable SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
rTTA-gRNA-AAV
Plasmid#213036PurposeThis vector contains rTTA expressed under CMV promoter and gRNA expressed under U6 promoterDepositorInsertrTTA-T2A-mCherry
UseAAV and CRISPRPromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hIKBKG_1k)-PGKpuro2ABFP-W
Plasmid#208410PurposeLentiviral gRNA plasmid targeting human IKBKG gene, co-expression of BFP tagDepositorInsertIKBKG (IKBKG Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(YYFF)-mRuby2
Plasmid#215447PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorTagsmRuby2MutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPB.DEST-ITGB1(YYFF)-mRuby2
Plasmid#215449PurposePiggybac expression vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseTransposon-based stable expressionTagsmRuby2ExpressionMammalianMutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoterCAGAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits