We narrowed to 7,224 results for: aav
-
Plasmid#220661PurposeAiE2367m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-GFAP-NLS-CasRx-NLS-FLAG-U6-DR-SgRNA_Ptbp1-DR
Plasmid#154001PurposeVector expressed CasRx and sgRNA_Ptbp1 for AAV packageDepositorInsertCasRx, Ptbp1 sgRNAs
UseAAV, CRISPR, and Mouse TargetingTagsFLAGPromoterGFAP, U6Available SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO hChR2(E123T/T159C)-mCherry
Plasmid#35510PurposeAAV expression of Ef1a-driven, cre-dependent, hChR2 variant for ultrafast optogenetic control.DepositorInserthChR2
UseAAVTagsmCherryExpressionMammalianMutationE123T and T159CPromoterEf1aAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a DIO-ChRmine-oScarlet-Kv2.1-WPRE
Plasmid#183525PurposeOptogeneticsDepositorInsertChRmine-oScarlet-Kv2.1
UseAAVPromoterEf1aAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
AiP1530 - pAAV-AiE2115m_3xC2-minBG-SYFP2-WPRE-BGHpA
Plasmid#220657PurposeAiE2115m_3xC2 is an optimized enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-NanoLuc-15aa linker-βarrestin2-no HA-GS linker-TEVp
Plasmid#125235PurposeExpresses SPARK2 NanoLuc-βarrestin2-TEVp (no HA) in mammalian cellsDepositorInsertNanoLuc-15aa linker-βarrestin2-no HA-GS linker-TEVp
UseAAVExpressionMammalianPromoterCMVAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-ChR2-TdTomato (Cre-OFF)
Plasmid#166610PurposeEncodes Cre-inactivated ChR2-TdTomato under control of the TREDepositorInsertChR2-TdTomato
UseAAVMutationH134RPromotertetracycline response elementAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [Jaws-KGC-tdTomato-ER2]
Plasmid#153536PurposeAAV-mediated expression of Jaws-KGC-tdTomato-ER2 under the Syn promoter, in floxed/reversed (Cre-dependent) manner.DepositorInsertJaws-KGC-tdTomato-ER2
UseAAVTagsER2, KGC, and tdTomatoExpressionMammalianMutationK200R W214FPromoterSynAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1a-DIO-GCaMP6s-P2A-nls-dTomato
Plasmid#51082PurposeCre dependent expression of GCaMP6s Ca sensor and physically separate nuclear localized dTomato fluorophoreDepositorHas ServiceAAV1InsertGCaMP6s
UseAAVTagsP2A-nls-dTomatoExpressionMammalianPromoterhEF1aAvailable SinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-NLS-mRuby3-IRES-eGtACR1-ST
Plasmid#109048PurposeAnion channelrhodopsin GtACR1 fused to ER export signal and targeted to the neuronal soma and proximal dendrites under the control of internal ribosome entry sequence in a viral vectorDepositorHas ServiceAAV9InserteGtACR1-ST
UseAAVPromoterCAGAvailable SinceJuly 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-oChIEF(E163A/T199C)-P2A-EGFP
Plasmid#51093PurposeForebrain principal neuron expression of oChIEF kinetic variant E163A/T199C with physically uncoupled EGFP fluorophoreDepositorInsertoChIEF(E163A/T199C)
UseAAVTagsP2A-EGFPExpressionMammalianMutationE163A/T199CPromoterCaMKIIaAvailable SinceMay 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-flex-iGABASnFR2(no bind)-WPRE
Plasmid#218879PurposeAAV-mediated expression of improved GABA sensor control (no change in fluorescence)DepositorHas ServiceAAV1 and AAV5InsertiGABASnFR2(no bind)
UseAAV and Cre/LoxExpressionMammalianMutationS99A F102G R168PPromoterSynapsinAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP7c variant 1513-WPRE
Plasmid#105321PurposeAAV-mediated expression of ultrasensitive protein calcium sensor under the Syn promoterDepositorHas ServiceAAV1InsertjGCaMP7c variant 1513
UseAAVTagsT7 epitope, Xpress tag, 6xHisExpressionMammalianPromoterSynapsinAvailable SinceJan. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA
Plasmid#50942PurposeBicistronic vector expressing mRuby2 and GCaMP6s from a single open reading frame.DepositorHas ServiceAAV1InsertmRuby2-P2A-GCaMP6s
UseAAVPromoterhSyn1Available SinceMarch 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
AiP1977 - pAAV-AiE2586m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214601PurposeAiE2586m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP
Plasmid#112677PurposeAn AAV vector that expresses a Cre-dependent nuclear-localized Red to Green Fluorescent proteinDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertNuclear-localized floxed-mCherry EGFP
UseAAVTagsNuclear localization signalPromoterEF1aAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-SpCas9_gRNA(RHO-P23H)-CMV-mTagBFP2_(RAS3613)
Plasmid#228252PurposepU6 (human U6) expression of SpCas9 sgRNA targeting RHO P23H mutation and pCMV expression of mTagBFP2DepositorInsertSpCas9 P23H sgRNA, mTagBFP2
ExpressionMammalianMutationn/aPromoterCMV and U6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
(565) pAAV Alb-AAT KRAB-SadCas9 U6-gSTOP
Plasmid#163030PurposeExpression of CRISPRi with gSTOP gRNADepositorInsertMammalian codon-optimized SadCas9
UseAAVTagsKRAB, SV40 pA, and myc NLSExpressionMammalianPromoterAlb-AATAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only