We narrowed to 5,531 results for: PEP
-
Plasmid#225660PurposeLentiviral expression of a cancer stem cell reporter that responds to presence of Sox2/Oct4 or their paralogs (green configuration)DepositorInsertdsCopGFP
UseLentiviralPromoterSORE6-mCMVpAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLM-CMV-R-Cre
Plasmid#27546PurposeLentiviral bicistronic co-expression of Cre and mCherry; linked by a P2A peptide.DepositorInsertmCherry_P2A_Cre recombinase
UseCre/Lox and LentiviralPromoterCMVAvailable SinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
MTNR1B-DuET
Plasmid#213349PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
OPRM1-DuET
Plasmid#213361PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 3xFlag IFIT3
Plasmid#53553Purposemammalian expression of IFIT3DepositorAvailable SinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
MTNR1A-DuET
Plasmid#213348PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCI-Caspase 1
Plasmid#41552DepositorInsertCaspase-1 (CASP1 Human)
TagsMycExpressionMammalianPromoterCMV immediate-early enhancer/promoterAvailable SinceDec. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDONR P2R-P3-SV40 polyA signal
Plasmid#48627PurposeContributes a cassette containing an SV40 polyA signal as the 3’-module during MultiSite Gateway cloning of chimeric cDNAs, when a peptide module at the C-terminal end is not required.DepositorInsertSV40 early polyadenylation signal cassette
UseGateway entry vectorPromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pACTA2_HL-P2A-eGFP-PGK-PuroR-ACTA2_HR
Plasmid#126705Purposedonor vector for targeting a 2A peptide followed by green fluorescent reporter to the human ACTA2 locus at the end of the endogenous coding sequenceDepositorInsertGFP
UseCRISPRAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+)-Gx-SB
Plasmid#220125PurposeExpresses the 1.3-kDa Small BiT (SB) fragment of split NanoLuc, genetically fused via a semi-rigid peptide linker to a protein G adapter domain (Gx).DepositorInsertGx-SB
ExpressionBacterialAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+)-Gx-LB
Plasmid#220126PurposeExpresses the 18-kDa Large BiT (LB) fragment of split NanoLuc, genetically fused via a semi-rigid peptide linker to a protein G adapter domain (Gx).DepositorInsertGx-LB
ExpressionBacterialAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
myristoylated ct-GRK2
Plasmid#178734PurposeN-myristoylation signaling peptide of Src and the C-terminal fragment of G-protein coupled receptor kinase 2 (ct-GRK2)DepositorInsertGRK2 (GRK2 Bovine)
UseLentiviralTagsSrc 1-15Mutationonly amino acids 548-671PromoterUbiquitinAvailable SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-B7
Plasmid#135509PurposeMammalian expression of myc-tagged HLA-B*07:02DepositorInsertHLA-B*07:02 (HLA-B Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D BARK p2A mCherry
Plasmid#117691PurposeGfaABC1D-iBARK-p2A-mCherry: Viral expression vector for astrocyte Gaq silencingDepositorInsertBARKrgs peptide
UseAAVTagsHA / FLAGAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pWPI_SPbFGF
Plasmid#25812DepositorInsertpWPI_SPbFGF (FGF2 Human)
UseLentiviralMutationIg signal peptide in N-terminal of human FGF2Available SinceJan. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pmTurquoise2-T2A-Venus(L68V)
Plasmid#60494PurposeProduces equimolar levels of mTurquoise2 and mVenus(L68V). It can be used as a negative control for FRET.DepositorInsertmTurquoise2-T2A-mVenus(L68V)
TagsT2A peptideExpressionMammalianPromoterCMVAvailable SinceOct. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pYPQ173
Plasmid#99907PurposeExpress CRISPR-Act2.0 system which contains pco-dCas9-VP64 fusion protein and MS2-VP64 fusion protein linked by in-frame T2A (encoding Thosea asigna 'self-cleaving' 2A peptide) sequenceDepositorInsertpco-dCas9-VP64-T2A-MS2-VP64
UseCRISPRExpressionPlantAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2
Plasmid#135504PurposeMammalian expression of myc-tagged HLA-A*02:01DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRoC30_Tv9nL
Plasmid#188069PurposePROSS-designed high-redox potential laccase from Trametes versicolorDepositorInsertPROSS-designed high-redox potential laccase from Trametes versicolor
TagsS. cerevisiae evolved α-factor prepro-leader sign…ExpressionYeastMutation79 PROSS mutations, described in publicationAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only