We narrowed to 967 results for: plasmids spcas9
-
Plasmid#228252PurposepU6 (human U6) expression of SpCas9 sgRNA targeting RHO P23H mutation and pCMV expression of mTagBFP2DepositorInsertSpCas9 P23H sgRNA, mTagBFP2
ExpressionMammalianMutationn/aPromoterCMV and U6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-(negative selection module)-Chimeric_BB-CBh-hSpCas9
Plasmid#223321PurposeIt contains a ccdB-CMr negative selection module flanked by BpiI (BbsI) sites that allows excluding clones without correct insertion of sgRNA. Human codon optimized Cas9 expressing plasmid.DepositorInsertsUseCRISPR and Synthetic BiologyExpressionMammalianPromoterCBhAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-HiFi SpCas9 (without sgRNA; with silent mutations)
Plasmid#126778PurposeExpression plasmid for human codon-optimized increased fidelity HiFi SpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertHiFi SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationR691APromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-Sniper SpCas9 (without sgRNA; with silent mutations)
Plasmid#126777PurposeExpression plasmid for human codon-optimized increased fidelity Sniper SpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertSniper SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationF539S, M763I, K890NPromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-SpCas9-HF1 (without sgRNA; with silent mutations)
Plasmid#126755PurposeExpression plasmid for human codon-optimized increased fidelity SpCas9-HF1 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertSpCas9-HF1
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926APromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-ABE8e(V106W)-SpCas9(D10A)-BPNLS-P2A-EGFP (CA77)
Plasmid#208290PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e(V106W) A-to-G base editor with SpCas9(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e(V106W)-SpCas9-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations and V106W in TadA and nSpCas9(D10…PromoterCMV and T7Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
874V=βTub-NLS-hSpCas9-T2A-GFP, Opie2-dsRed-SV40
Plasmid#159672PurposePlasmid supports Cas9 expression only in males, Opie2-dsRed tagged, and can be integrated with pBac or phC31.DepositorInsertβTub-NLS-hSpCas9-T2A-GFP
TagsT2A-GFPExpressionInsectAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
874U=ExuL-NLS-hSpCas9-T2A-GFP, Opie2-dsRed-SV40
Plasmid#159671PurposePlasmid supports Cas9 expression only in males, Opie2-dsRed tagged, and can be integrated with pBac or phC31.DepositorInsertExuL-NLS-hSpCas9-T2A-GFP
TagsT2A-GFPExpressionInsectAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
1095=Rcd-1r-NLS-hSpCas9-T2A-GFP, Opie2-dsRed-SV40
Plasmid#159673PurposePlasmid supports Cas9 expression in both males and females, Opie2-dsRed tagged, and can be integrated with pBac or phC31.DepositorInsertRcd-1r-NLS-hSpCas9-T2A-GFP, Opie2-dsRed-SV40
TagsT2A-GFPExpressionInsectAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX261-U6-DR-hEmx1-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-puro
Plasmid#42337PurposeDual expression plasmid of human codon-optimized SpCas9 and a gRNA to the human Emx1 locus, can be used to test SpCas9 cleavage in cell lines of choice.DepositorArticleInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianAvailable SinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCSD_FKBP-C-SpCas9MT3-574-1368-NLS-3XHA-NLS-ZFPTS3-3xFLAG-2xNLS
Plasmid#107300PurposeExpresses C terminal (574-1368 aa) R1335K mutant SpCas9 fused to FKBP and ZFP-VEGFA-TS3 in mammalian cellsDepositorInsertTruncated SpCas9 (aa 574-1368) fused to FKBP
UseCRISPRTags3x Flag, 2x NLS, FKBP, SV40NLS, 3xHA, c-Myc NLS, …ExpressionMammalianMutationTruncated SpCas9 (aa 574-1368) with R1335K mutati…PromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSD_FKBP-C-SpCas9MT3-574-1368-NLS-3XHA-NLS-ZFPTS2-3xFLAG-2xNLS
Plasmid#107299PurposeExpresses C terminal (574-1368 aa) R1335K mutant SpCas9 fused to FKBP and ZFP-VEGFA-TS2 in mammalian cellsDepositorInsertTruncated SpCas9 (aa 574-1368) fused to FKBP
UseCRISPRTags3x Flag, 2x NLS, FKBP, SV40NLS, 3xHA, c-Myc NLS, …ExpressionMammalianMutationTruncated SpCas9 (aa 574-1368) with R1335K mutati…PromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-nSpCas9(H840A)-BPNLS(SV40)-3xFLAG-P2A-EGFP (HES140)
Plasmid#185490PurposeCMV and T7 promoter expression plasmid for human codon usage nSpCas9(H840A) with a C-terminal bi-partite NLS, 3x FLAG, and P2A-eGFPDepositorInserthuman codon usage nSpCas9(H840A)-BPNLS-P2A-eGFP
UseIn vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-eGFPExpressionMammalianMutationH840APromoterCMV and T7Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-nSpCas9(D10A)-BPNLS(SV40)-3xFLAG-P2A-EGFP (HES24)
Plasmid#185492PurposeCMV and T7 promoter expression plasmid for human codon usage nSpCas9(D10A) with a C-terminal bi-partite NLS, 3x FLAG, and P2A-eGFPDepositorInserthuman codon usage nSpCas9(D10A)-BPNLS-P2A-eGFP
UseIn vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-eGFPExpressionMammalianMutationD10APromoterCMV and T7Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-Puro-U6-gRNA-pA plasmid
Plasmid#247671PurposespCas9 gRNA is driven by human U6 promoter, with the gRNA cassette between PuroR and pA, making it detectable in polyA-based RNA-seq.DepositorInsertPuromycin resistant gene
ExpressionMammalianPromoterTK promoterAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
KO plasmid
Plasmid#135970PurposeExpresses SpCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneExpressionMammalianAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGG438
Plasmid#165486PurposeVector for expression of the SpCas9 VRKG variant in human cells: CMV-T7-humanVRKG(SpCas9, D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFLAGDepositorInsertMammalian codon-optimized Streptococcus pyogenes Cas9 VRKG(D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFlag
UseCRISPRTags3x FLAG and SV40 NLSExpressionMammalianMutationD1135V, S1136R, D1332K, and R1333G mutations in S…PromoterCMV and T7Available SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LP102: pMAGIC (R4-R3) NLS-Sp Cas9-NLS
Plasmid#132927PurposepMAGIC R4-R3 entry plasmid, contains 2xNLS SpCas9 (nuclease active) for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInserthumanized SpCas9
UseCRISPR and Synthetic Biology; Pmagic gateway entr…Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX551
Plasmid#60957PurposepAAV-pMecp2-SpCas9-spA (AAV-SpCas9). AAV plasmid expressing Cas9 in neurons under control of truncated mecp2 promoter.DepositorInsertSpCas9
UseAAV and CRISPRTagsHAExpressionMammalianPromoterpMecp2Available SinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only