We narrowed to 11,805 results for: NSI;
-
Plasmid#114886PurposePrey vector BRI1 BRI1_pECIA14 should be used with bait vector BRI1 BRI1_pECIA2.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pCDNA3 UQCC2(5’UTR)-FF
Plasmid#85487PurposeFirefly luciferase under the control of UQCC2 5'UTRDepositorAvailable SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_DM1-3_H0-ABD+
Plasmid#234554PurposeCTNNA1 M-domain deletion mutant with enhanced actin-binding domain mutationsDepositorAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-SUMO-m-cGAS(I309T)
Plasmid#232295PurposeExpression of mutant mouse cGAS protein (I309T)DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
BPK1520-sgRNA GLB1
Plasmid#184378PurposeExpresses a sgRNA to edit GLB1 gene NM_000404.2_c.907A>GDepositorAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA893 - pBA904 Puro-T2A-BFP KLF5 g1 CRISPRa guide guide (pRCA594 backbone) 666
Plasmid#238186PurposeLentiviral CRISPR guide vector expressing a KLF5 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Plxnd1 sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239032PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceAug. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA860 - pBA904 Puro-T2A-GFP EGR3 g1 CRISPRa guide guide (pRCA360 backbone)
Plasmid#238188PurposeLentiviral CRISPR guide vector expressing a EGR3 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hBIRC3_1k)-PGKpuro2ABFP-W
Plasmid#208418PurposeLentiviral gRNA plasmid targeting human BIRC3 gene, co-expression of BFP tagDepositorInsertBIRC3 (BIRC3 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hBIRC3_2b)-PGKpuro2ABFP-W
Plasmid#208419PurposeLentiviral gRNA plasmid targeting human BIRC3 gene, co-expression of BFP tagDepositorInsertBIRC3 (BIRC3 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hCASP8_1k)-PGKpuro2ABFP-W
Plasmid#208422PurposeLentiviral gRNA plasmid targeting human CASP8 gene, co-expression of BFP tagDepositorInsertCASP8 (CASP8 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hCASP8_2b)-PGKpuro2ABFP-W
Plasmid#208423PurposeLentiviral gRNA plasmid targeting human CASP8 gene, co-expression of BFP tagDepositorInsertCASP8 (CASP8 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hTNF_2b)-PGKpuro2ABFP-W
Plasmid#208426PurposeLentiviral gRNA plasmid targeting human TNF gene, co-expression of BFP tagDepositorInsertTNF (TNF Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMAP3K7_1k)-PGKpuro2ABFP-W
Plasmid#208412PurposeLentiviral gRNA plasmid targeting human MAP3K7 gene, co-expression of BFP tagDepositorInsertMAP3K7 (MAP3K7 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMAP3K7_2m)-PGKpuro2ABFP-W
Plasmid#208413PurposeLentiviral gRNA plasmid targeting human MAP3K7 gene, co-expression of BFP tagDepositorInsertMAP3K7 (MAP3K7 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_DM1-3_WT-ABD
Plasmid#234553PurposeCTNNA1 M-domain deletion mutantDepositorInsertmEGFP:hCTNNA1_DM-domain (CTNNA1 Human)
UseLentiviralTagsmEGFPMutationDeletion of aa 273-635PromoterCMVAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_L436P
Plasmid#234559PurposeCTNNA1 eye phenotype via forward genetic screenDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA805 - pBA904 Puro-T2A-GFP KLF4 g1 CRISPRa guide (pRCA360 backbone) 668
Plasmid#238174PurposeLentiviral CRISPR guide vector expressing a KLF4 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA803 - pBA904 Puro-T2A-GFP KLF5 g1 CRISPRa guide (pRCA360 backbone) 666
Plasmid#238172PurposeLentiviral CRISPR guide vector expressing a KLF5 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA804 - pBA904 Puro-T2A-GFP KLF5 g2 CRISPRa guide (pRCA360 backbone) 665
Plasmid#238173PurposeLentiviral CRISPR guide vector expressing a KLF5 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA895 - pBA904 Puro-T2A-BFP KLF4 g1 CRISPRa guide guide (pRCA594 backbone) 668
Plasmid#238187PurposeLentiviral CRISPR guide vector expressing a KLF4 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Rorb sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239029PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Satb2 sesRNA-2a-msFlag-2a-tTA-WPRE
Plasmid#239028PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ClipF-HA-2a-Hu VGAT sesRNA-2a-smV5-2a-tTA2-WPRE
Plasmid#239031PurposeExpression of ClipF, sesRNA in mammalian cells, with smV5 and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NONO2_IDR-EGFP
Plasmid#232765PurposeExpresses dCas9-NONO2_IDR-EGFPDepositorAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NUP98b_IDR-EGFP
Plasmid#232767PurposeExpresses dCas9-NUP98b_IDR-EGFPDepositorAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
EWSR1_IDR-EGFP
Plasmid#232755PurposeExpresses EWSR1_IDR-EGFPDepositorAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
NONO1_IDR-EGFP
Plasmid#232757PurposeExpresses NONO1_IDR-EGFPDepositorAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
NONO2_IDR-EGFP
Plasmid#232758PurposeExpresses NONO2_IDR-EGFPDepositorAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
NUP98a_IDR-EGFP
Plasmid#232759PurposeExpresses NUP98a_IDR-EGFPDepositorAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
NUP98b_IDR-EGFP
Plasmid#232760PurposeExpresses NUP98b_IDR-EGFPDepositorAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
dCas9-EWSR1_IDR-EGFP
Plasmid#232762PurposeExpresses dCas9-EWSR1_IDR-EGFPDepositorAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
dCas9-SS18_IDR-EGFP
Plasmid#232763PurposeExpresses dCas9-SS18_IDR-EGFPDepositorAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NONO1_IDR-EGFP
Plasmid#232764PurposeExpresses dCas9-NONO1_IDR-EGFPDepositorAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
p2T-CMV-EA-evoAPOBEC1max_NG-BlastR
Plasmid#232721PurposeC-to-T base editorDepositorInsertevoAPOBEC1max H47E+S48A-nCas9(NG)-UGI-UGI
ExpressionMammalianMutationwithin evoAPOBEC1: H47E+S48A; within Cas9 D10AAvailable SinceMarch 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 shCavin1KDR-EGFP
Plasmid#187254PurposeLentiviral expression of shRNA targeting Cavin1 + reconstitution of mouse Cavin1 (Cavin1 rescue)DepositorAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ GFP-CDK5R1 degron (283-307)-IRES-mCherry
Plasmid#231008PurposeProtein stability reporter construct for CDK5R1 consisting of aa 283-307 for transient overexpression in mammalian cells.DepositorAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCA528 CHMP1B 143-199
Plasmid#108255PurposeExpresses C-terminal 143-199 residues of CHMP1B with non-native N-term cysteine for fluorescent labeling; Internal ID: WISP18-2DepositorInsertCHMP1B residues 143-199 (CHMP1B Human)
TagsHis-SUMOExpressionBacterialMutationContains nonnative Gly-Cys for fluorescent labeli…PromoterT7Available SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCA528 CHMP4B 156-224
Plasmid#104596PurposeExpresses C-terminal 156-224 residues of CHMP4B with non-native N-term cysteine for fluorescent labeling; Internal ID: WISP18-7DepositorInsertCHMP4B residues 156-224 (CHMP4B Human)
TagsHis-SUMOExpressionBacterialMutationContains nonnative Gly-Cys for fluorescent labeli…PromoterT7Available SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only