We narrowed to 6,293 results for: cat.2
-
Plasmid#99848PurposeExpresses Cre-recombinase, a barcoded HDR template that serves as a control for HDR into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-ARID1A-deltaIDR1IDR2-FLAG
Plasmid#242213PurposeExpression of human ARID1A ∆IDR1 and ∆IDR2 (deletion of a.a. 2-970 and a.a. 1170-1610) using piggyBac transpositionDepositorInsertARID1A (ARID1A Human)
UsePiggybacTagsFLAGExpressionMammalianMutationDeleted IDR1 and IDR2 from ARID1A (deletion of a.…PromoterCAGAvailable SinceSept. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC-His+MFN2[∆TM,∆HB2]-Strep (SB261)
Plasmid#227610PurposeInducible coexpression of His-tagged SLC25A46 and Strep-tagged MFN2 lacking its transmembrane region and helical bundle 2 (HB2) in Pichia pastorisDepositorTags10xHis and Twin-StrepTagExpressionYeastMutationcontains aa 2-400, 706-757 [TM and HB2 deleted]PromoterAOX1Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pBolux
Plasmid#188109PurposeEncodes a promoter-less Bacteroides-optimized lux cassetteDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAMPK alpha2 delta312X
Plasmid#60127Purposeexpresses constitutively active AMPKalpha2DepositorAvailable SinceNov. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shTEAD1/3/4-1
Plasmid#193672PurposeConstitutive lentiviral expression of TEAD shRNADepositorInsertTEAD
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shPRDM14-1
Plasmid#193694PurposeConstitutive lentiviral expression of PRDM14 shRNADepositorInsertPRDM14 (PRDM14 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shPRDM14-5
Plasmid#193698PurposeConstitutive lentiviral expression of PRDM14 shRNADepositorInsertPRDM14 (PRDM14 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
HOXC5 (human) HIS-tag pET
Plasmid#8563DepositorInsertHOXC5 (HOXC5 Human)
TagsHis and T7ExpressionBacterialMutationStarts at Amino Acid #2 (Ser); makes protein by W…Available SinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pC001 - huLshC2C2-MBP for bacterial expression
Plasmid#79150PurposeExpresses human codon-optimized LshC2c2 for purification in E. coliDepositorInsertC2c2
ExpressionBacterialPromoterT7Available SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPPI4-Strep-SNAP-PD-1
Plasmid#223569PurposeProtein purification of human PD-1 with Twin-Strep and SNAP tags from mammalian cellsDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cas12f-GE ver4.0
Plasmid#176543PurposeExpresses Cas12f-GE in mammalian cellsDepositorInsertsCas12f-GE ver4.0
Cas12f-GE ver4.0
ExpressionMammalianPromoterU6 and chicken β-actinAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cas12f-GE ver3.0
Plasmid#176508PurposeExpresses Cas12f-GE in mammalian cellsDepositorInsertsCas12f-GE ver3.0
Cas12f-GE ver3.0
ExpressionMammalianPromoterU6 and chicken β-actinAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPapi
Plasmid#96921Purposeexpression of S aureus SaCas9 (SauCas9) and two pol III promoters for an Sa gRNA and an Sp gRNA. Intended to be used in SpCas9-expressing cell lines for dual Cas9 "Big Papi" screens. aka pXPR207.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
Cas12f-GE ver4.1
Plasmid#176544PurposeExpresses Cas12f-GE in mammalian cellsDepositorInsertsCas12f-GE ver4.1
Cas12f-GE ver4.1
ExpressionMammalianPromoterU6 and chicken β-actinAvailable SinceOct. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B
Plasmid#103002Purposenon-standard AAV2 rep-AAV-PHP.B cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
HyperADAR control
Plasmid#166969PurposeExpress the Hyperactive catalytic domain of Drosophila ADAR and linker at the 5' end of this domain, in the MSCV-IRES-GFPDepositorInsertlinker-hyperADAR
UseRetroviralTagslinker-HyperADARExpressionMammalianPromoterMSCVAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSI2-ADA
Plasmid#166967PurposeExpress the fusion protein of human MSI2 and the hyperactive catalytic domain of Drosophila ADARDepositorInsertMSI2-ADA
UseRetroviralTagsMSI2-ADAExpressionMammalianPromoterMSCVAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only