We narrowed to 4,932 results for: pAAV
-
Plasmid#220607PurposeFlp-dependent expression of a single-cell discriminating version of mKate2 fluorescent protein.DepositorInsertmKate2
UseAAVTagsArgiNLSExpressionMammalianMutationPromoterCAGAvailable sinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-fDIO-ArgiNLS-oScarlet
Plasmid#220606PurposeFlp-dependent expression of a single-cell discriminating version of oScarlet fluorescent protein.DepositorInsertoScarlet
UseAAVTagsArgiNLSExpressionMammalianMutationPromoterCAGAvailable sinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-ArgiNLS-mVenus-Q69M(ME)
Plasmid#220597PurposeConstitutive expression of a single-cell discriminating version of mVenus-Q69M (ME) fluorescent protein.DepositorInsertmVenus-Q69M (ME)
UseAAVTagsArgiNLSExpressionMammalianMutationPromoterEF1aAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-ArgiNLS-EGFP
Plasmid#220601PurposeCre-dependent expression of a single-cell discriminating version of EGFP fluorescent proteinDepositorInsertEGFP
UseAAV and Cre/LoxTagsArgiNLSExpressionMammalianMutationPromoterCAGAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GCaMP6f-WPRE
Plasmid#216275PurposeAAV vector with hSynapsin promoter and DIO Lox sites for Cre-On expression of green fluorescent calcium indicator GCaMP6fDepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressExpressionMutationPromoterhuman Synapsin 1 (hSyn)Available sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-ConVERGD-eGFP-W3SL
Plasmid#218748PurposeProvides AND intersectional (Cre+Flp) expression of eGFPDepositorInserteGFP
UseAAVTagsExpressionMutationPromoterCAGAvailable sinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-FAS-GCaMP6f-WPRE
Plasmid#141237PurposeAAV vector with Ef1a promoter and LoxFAS sites for Cre-Off expression of GCaMP6f (GCaMP6f will not be expressed in mammalian cells that express Cre recombinase)DepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressExpressionMutationPromoterHuman elongation factor-1 alpha (EF-1 alpha)Available sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-2xflox-BRX-eGFP-NLS
Plasmid#217535PurposeAAV vector to drive the expression of eGFP in genetically defined cell populations under the control of the 4xBRE regulatory element of SMAD1 transcription factor and miniXon splicing casette in vivoDepositorArticleInsert4X BRE reporter and miniXon casette (Smad1 Mouse)
UseAAVTagsExpressionMammalianMutationPromoterBMP response element (BRE)Available sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgFAAH
Plasmid#209197PurposeMutagenesis of FaahDepositorInsertFaah (Faah Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterCMVAvailable sinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only