We narrowed to 6,471 results for: poly
-
Plasmid#201579PurposeExpresses a variant of human RAD23A containing mutations C344A and F354A within UBA2. Variant of plasmid pCMV6-AN-DDK_WT RAD23ADepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
UseTagsFLAGExpressionMammalianMutationContains mutations C344A and F354APromoterAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT RAD23B_delta aa 276-339 (delta XPC-binding domain)
Plasmid#201547PurposeExpresses a mutant form of human RAD23B that lacks the XPC-binding domain. Variant of plasmid pCMV6-AN-DDK_WT RAD23BDepositorInsertUV excision repair protein RAD23 homolog B (RAD23B Human)
UseTagsFLAGExpressionMammalianMutationLacks residues 276-339PromoterAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT RAD23A
Plasmid#201438PurposeExpresses human RAD23A with an N-terminal FLAG tag in mammalian cellsDepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
UseTagsFLAGExpressionMammalianMutationPromoterCMVAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19-TdTc253
Plasmid#207464PurposeBacterial expression of Terminal deoxynucleotidyl transferase (TdT) cysteine variant. Only one surface-exposed cysteine, at residue 253DepositorInsertMTdTc253 (Dntt Mouse)
UseTags10xHisExpressionBacterialMutationSer253Cys, Cys188Ala, Cys216Ser, Cys302Ala, Cys37…PromoterAvailable sinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19-TdTc188
Plasmid#207463PurposeBacterial expression of Terminal deoxynucleotidyl transferase (TdT) cysteine variant. Only one surface-exposed cysteine, at residue 188DepositorInsertTdTc188 (Dntt Mouse)
UseTags10xHisExpressionBacterialMutationCys216Ser, Cys302Ala, Cys378Ala, and Cys438SerPromoterAvailable sinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19-TdTc180
Plasmid#207462PurposeBacterial expression of Terminal deoxynucleotidyl transferase (TdT) cysteine variant. Only one surface-exposed cysteine, at residue 180DepositorInsertTdTc180 (Dntt Mouse)
UseTags10xHisExpressionBacterialMutationGlu180Cys, Cys188Ala, Cys216Ser, Cys302Ala, Cys37…PromoterAvailable sinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19-TdTc302
Plasmid#207461PurposeBacterial expression of Terminal deoxynucleotidyl transferase (TdT) cysteine variant. Only one surface-exposed cysteine, at residue 302DepositorInsertTdTc302 (Dntt Mouse)
UseTags10xHisExpressionBacterialMutationCys188Ala, Cys216Ser, Cys378Ala, and Cys438SerPromoterAvailable sinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsUseTagsExpressionBacterialMutationPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRR-C421-G2304D
Plasmid#182845Purposemutation G2304D (GGC/GAC), PCR product coding C-terminal residues 2011-2431 of TRR was inserted into modified pGEX-2T by Nde I-Nsi I sitesDepositorInsertTRR 2011-2431 (trr Fly)
UseTagsGSTExpressionBacterialMutationmutation G2304D (GGC/GAC)PromoterAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRX-C751-E3616S
Plasmid#182844Purposemutation E3616S (GAA/TCA), PCR product coding C-terminal residues 2976-3726 of TRX was inserted into modified pGEX-2T by Nde I-Nsi I sites. Expression in E. coli. by IPTG inductionDepositorInsertTRX (w Fly)
UseTagsGSTExpressionBacterialMutationPromoterAvailable sinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-Flag-PolB(K206A/K244A/T304I)-Puro
Plasmid#177145PurposeLentiviral vector expressing Flag-PolB(K206A/K244A/T304I) and a puromycin resistance cassetteDepositorInsertPolB (POLB Human)
UseLentiviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-NQO1(Y128F)
Plasmid#177141PurposeBacterial vector for expression of an N-terminal GST fusion of NQO1(Y128F) with a TEV protease site located between the GST tag and NQO1(Y128F)DepositorInsertNQO1 (NQO1 Human)
UseTagsGSTExpressionBacterialMutationPromoterTacAvailable sinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-PolB(L301R/V303R/V306R)
Plasmid#177137PurposeBacterial vector for expression of an N-terminal GST fusion of PolB(L301R/V303R/V306R) with a TEV protease site located between the GST tag and PolB(L301R/V303R/V306R)DepositorInsertPolB (POLB Human)
UseTagsGSTExpressionBacterialMutationPromoterTacAvailable sinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-PolB(K206A/K244A/T304I)
Plasmid#177134PurposeBacterial vector for expression of an N-terminal GST fusion of PolB(K206A/K244A/T304I) with a TEV protease site located between the GST tag and PolB(K206A/K244A/T304I)DepositorInsertPolB (POLB Human)
UseTagsGSTExpressionBacterialMutationPromoterTacAvailable sinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-DEST42-dre4
Plasmid#170440PurposeExpress drosophila dre4 in E.coli expression system. Generated from pDONR-dre4 by Gateway system. Used for custom antibody purification.DepositorInsertdre4 (dre4 Fly)
UseTags6xHis and V5ExpressionBacterialMutationDeleted amino acids 1-20PromoterT7Available sinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3400 (YCp LEU2 Rpb1 A1529_G1534delInsLEVLFQGP)
Plasmid#91806PurposeYeast expression of S. cerevisiae Rpb1 with an internal PreScission protease siteDepositorInsertRPO21 (RPO21 Budding Yeast)
UseTagsExpressionYeastMutationResidues A1529-G1534 replaced with a PreScission …PromoterEndogenous Rpb1 promoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3477 (YCp LEU2 Rpb1 P1455_E1456InsLEVLFQGP)
Plasmid#91807PurposeYeast expression of S. cerevisiae Rpb1 with an internal PreScission protease siteDepositorInsertRPO21 (RPO21 Budding Yeast)
UseTagsExpressionYeastMutationPreScission Protease site (LEVLFQGP) inserted bet…PromoterEndogenous Rpb1 promoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3506 (pET151_Spt6 1247-1451 K1355A,K1435A)
Plasmid#91818PurposeBacterial expression of residues 1247-1451 from S. cerevisiae Spt6 with K1435A and K1355A mutationsDepositorInsertSPT6 (SPT6 Budding Yeast)
UseTags6xHisExpressionBacterialMutationchanged lysine 1355 and lysine 1435 to alanines; …PromoterT7Available sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-Flag-Rheb-12Rs
Plasmid#165023Purposeexpression of Flag-Rheb-12Rs mutant protein in mammalian cells (all the lysine residues on Rheb except the K19 and K120 are mutated to arginines).DepositorInsertRheb-12Rs (RHEB Human)
UseLentiviralTagsflagExpressionMammalianMutationAll the lysine residues except K19 and K120 are c…PromoterAvailable sinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_gRNA_H19-DMR-2
Plasmid#159930PurposeSpecific gRNA against mouse H19-DMR cloned in the pX330 backbone (Addgene Number 42230). Deletion of H19-DMR in mouse ESC.DepositorInsertgRNA mouse H19-DMR (H19-icr Mouse)
UseCRISPR and Mouse TargetingTagsExpressionMammalianMutationPromoterU6, CBhAvailable sinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only