We narrowed to 4,691 results for: POR C
-
Plasmid#135092PurposeTranscriptional GFP reporter of acr-2 (cholinergic) expressing neurons in C. elegansDepositorInsertPacr-2
UseTagsGFP and Synthetic IntronExpressionWormMutationPromoterPacr-2Available SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-myc-GLUT4-mCherry
Plasmid#64049Purpose3rd generation lentiviral transfer plasmid. Reporter for GLUT4 translocationDepositorInsertGLUT4 (Slc2a4 Mouse)
UseLentiviralTagsc-Myc and mCherryExpressionMammalianMutationPromoterUbiquitinAvailable SinceJuly 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
phage ubc nls ha pcp gfp
Plasmid#64539PurposeUsed to label reporter mRNAs. Lentiviral expression of the PP7 coat protein fused to EGFP.DepositorInsertPCP
UseLentiviralTagsEGFP, FactorXa site, HA, and NLSExpressionMammalianMutationPromoterhuman ubiquitin C promoterAvailable SinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUAS-V5-TurboID-NES
Plasmid#116904PurposeExpresses TurboID under Gal4/UAS control. TurboID is tagged at the N-terminus with V5 and a nuclear export signal (NES) at the C-terminus.DepositorInsertTurboID
UseDrosophila expressionTagsExpressionMutationPromoterAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUAS-V5-miniTurboID-NES
Plasmid#116905PurposeExpresses miniTurboID under Gal4/UAS control. miniTurboID is tagged at the N-terminus with V5 and a nuclear export signal (NES) at the C-terminus.DepositorInsertminiTurboID
UseDrosophila expressionTagsExpressionMutationPromoterAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
Beta-Globin-WT
Plasmid#130700PurposeExpresses Beta-Globin WT NMD reporterDepositorAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
PZac2.1 gfaABC1D-Aqp4-eGFP
Plasmid#176747PurposeExpresses Aquaporin-4 fused with eGFP at the C-terminus in astrocytesDepositorInsertAqp4-eGFP
UseAAVTagsGFPExpressionBacterialMutationPromotergfaABC1DAvailable SinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
UAS:bloSwitch
Plasmid#108355PurposeUAS driven green to red switch reporter for B3 recombinase expressionDepositorInsertUAS:[Ubiquitin-C-intron]-[blown-out site]-nuclear-GFP-[beta-globin-polyA]-[blown out site]-[membrane TagRFPT]
UseZebrafish expressionTagsExpressionMutationZebrafish codon optimizedPromoterlacAvailable SinceSept. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKERepPar
Plasmid#211827PurposeMedium copy number protein expression plasmid, suitable for electroporation in C. necator. Containes eGFP as model protein and a RP4 partitioning system to increase segregational stability.DepositorInserteGFP
UseTagsExpressionBacterialMutationPromoterT5Available SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
VGluT1-SNAPtag
Plasmid#107371PurposeSynaptic vesicle protein VGluT1 fused to the SNAPtag domainDepositorInsertVesicular Glutamate transporter 1 (Slc17a7 Rat)
UseTagsSNAPtag, 104 aa before C termExpressionMammalianMutationPromoterAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cas9-PCV
Plasmid#123644PurposeExpresses Cas9 with a C-terminal HUH-tag called PCV2 in E. coliDepositorAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
EGFP-hPMCA4b delta6
Plasmid#47590DepositorInsertPMCA4bdelta6 (ATP2B4 Human)
UseTagsEGFPExpressionMammalianMutation6 C-terminal AA deleted (needed for PDZ binding)PromoterCMVAvailable SinceAug. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKT-IDH1(R132H)-IRES-Katushka
Plasmid#124257PurposeExpresses IDH1 with a R132H mutation and katushka fluorescent reporter. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertIsocitrate dehydrogenase 1 (R132H) (IDH1 Human)
UseTagsExpressionMammalianMutationArginine 132 is mutated to Histidine. This mutati…PromoterAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
UseTagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1a-XRCC1-EGFP-T2A-Myc-POLB(D256A/PAMmut)
Plasmid#176141PurposeEGFP fused to the C-terminus of XRCC1, linked by T2A to N-terminus Myc-tagged POLB with the mutation Asp256Ala, a mutation in the PAM site used by POLBKO gRNA1 & a hygromycin resistance cassetteDepositorUseLentiviralTagsEGFP and MYCExpressionMammalianMutationMyc-tagged PolB with mutation in Asp256 to Ala, a…PromoterEF1AAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
3NES-CS(G)-tTA-CS(G)-3NES
Plasmid#137836PurposeSoluble tTA transcription factor flanked by N and C terminal TEV protease G cleavage sequences and 3 nuclear export sequencesDepositorInsert3NES-CD(G)-tTA-CS(G)-3NES
UseTagsExpressionMammalianMutationPromoterCMVAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMTS-hFluc-HA-GFP11
Plasmid#177726PurposeFirefly luciferase reporter fused to a mitochondria signal sequence for mitochondrial targeting with an HA tag and the eleventh β-strand of GFP added to the C-terminusDepositorInserthFluc
UseTagsGFP11, HA, and Mitochondrial Targeting SequenceExpressionBacterial and MammalianMutationPromoterAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cyto-ExRai-CKAR2
Plasmid#236097PurposeCytosol-targeted enhanced excitation-ratiometric biosensor for monitoring Protein Kinase C activity in living cells.DepositorInsertExRai-CKAR2-NES
UseTags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianMutationPromoterCMVAvailable SinceMay 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKESaPar
Plasmid#211829PurposeLow copy number protein expression plasmid, suitable for electroporation in C. necator. Containes eGFP as model protein and a RP4 partitioning system to increase segregational stability.DepositorInserteGFP
UseTagsExpressionBacterialMutationPromoterT5Available SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLP_mod_mNeonGreen11_P2A_puroR_CRE-GFP
Plasmid#229227PurposeModular BxB1 landing pad vector containing C-term mNeonGreen11 tag, puroR marker, and a cAMP GFP reporter.DepositorTypeEmpty backboneUseTagsmNeonGreen11ExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only