We narrowed to 9,127 results for: Pol
-
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTL335
Plasmid#168397PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertOsaHIP24
ExpressionYeastAvailable SinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTL336
Plasmid#168396PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertOsaHIP34
ExpressionYeastAvailable SinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAct-GST-H3(K27Q)
Plasmid#182843Purposea K27Q point mutation (AAG/CAG) of Drosophila histone H3 was generated from pAct-GST-H3. Expression in S2 cells.DepositorInsertGST-histone H3 fusion
TagsGSTExpressionInsectPromoterActin5CAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAct-GST-H3
Plasmid#182842PurposeA PCR product encoding GST-H3 (Drosophila histone H3) was was inserted into a modified pAct-5c vector by Sac I and Sal I sites. Expression in S2 cells.DepositorInsertGST-histone H3 fusion
TagsGSTExpressionInsectPromoterActin5CAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
gSCPL35-mRFP
Plasmid#181960PurposeSCPL35 protein tagged with mRFP, under control of native promoterDepositorInsertSCPL35
TagsmRFPExpressionPlantPromoternative SCPL35Available SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
Antares2-N1
Plasmid#120869PurposePiggybac transposon plasmid for live animal optical imagingDepositorInsertAkaluc
ExpressionMammalianPromoterCMV PromoterAvailable SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTL95
Plasmid#168329PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertSi514802025
ExpressionYeastAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTL316
Plasmid#168377PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertLOC_ Os08g40130
ExpressionYeastAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTL328
Plasmid#168389PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertOsaHIP48
ExpressionYeastAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTL360
Plasmid#168421PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertLOC_ Os01g70240
ExpressionYeastAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTL373
Plasmid#168434PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertOsaHIP12
ExpressionYeastAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTL362
Plasmid#168423PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertLOC_ Os04g32860
ExpressionYeastAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTL350
Plasmid#168411PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertOsaCCH
ExpressionYeastAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTL386
Plasmid#168447PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertOsaHIP07
ExpressionYeastAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTL351
Plasmid#168412PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertOsaHIP31
ExpressionYeastAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTL372
Plasmid#168433PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertOsaHIP16
ExpressionYeastAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTL348
Plasmid#168409PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertOsaHIP45
ExpressionYeastAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTL361
Plasmid#168422PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertOsaHIP40
ExpressionYeastAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTL374
Plasmid#168435PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertLOC_ Os02g48170
ExpressionYeastAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only