We narrowed to 7,550 results for: aav
-
Plasmid#176279PurposeViral vector for co-expression of non-functional Kir2.1 and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertKir2.1MUT-P2A-EGFP (Kcnj2 Synthetic, Mouse)
UseAAV and Cre/LoxTagsMycExpressionMammalianMutationGYG to AAA (aa144-146)Promoterhuman Synapsin IAvailable SinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
1255_pAAV-U6-SA-BbsI-MluI-gRNA-CB-SACas9-HA-OLLAS-spA
Plasmid#109320PurposePlasmid for AAV SaCas9 Mammalian Expression with a BbsI cloning site for a gRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hnEF Coff/Fon hChR2(H134R)-EYFP
Plasmid#55649PurposeCre-off/Flp-on ChR2-EYFP under the short Ef1a promoterDepositorInsertChR2(H134R)-EYFP
UseAAV; Cre off/flp on chr2-eyfpTagsEYFPExpressionMammalianPromoterShort Ef1Available SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM3D(Gq)-mCherry-shLacZ-CWB
Plasmid#223660PurposeExpresses hM3D(Gq) and a control shRNA (targetting LacZ) in a Cre-dependent mannerDepositorInserthM3D(Gq)-mCherry and shLacZ
UseAAV and RNAiTagsmCherryExpressionMammalianPromoterhSynAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-Vgf-T2A-mCherry-CW3SL
Plasmid#223661PurposeExpresses VGF and mCherry in a Cre-dependent mannerDepositorInsertVgf-T2A-mCherry
UseAAVExpressionMammalianPromoterhSynAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM3D(Gq)-mCherry-shVgf-CWB
Plasmid#223658PurposeExpresses hM3D(Gq) and a shRNA targetting VGF in a Cre-dependent mannerDepositorInserthM3D(Gq)-mCherry and shVGF
UseAAV and RNAiTagsmCherryExpressionMammalianPromoterhSynAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP978-pAAV-mscRE4-minBGpromoter-FlpO-WPRE-hGHpA
Plasmid#163472PurposeDirect-expressing FlpO AAV Virus. Alias: AiP978 - pAAV-AiE2004m-minBG-FlpO-WPRE-HGHpADepositorInsertFlpO
UseAAVPromoterBeta Globin minimal promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-HA-KORD-IRES-mCitrine-WPREpA
Plasmid#154871PurposeHuman synapsin-1 promoter; Flp-dependent KORD-IRES-mCitrineDepositorInsertKORD-IRES-mCitrine
UseAAV; Flp-frtTagsHAExpressionMammalianPromoterHuman Synapsin-1Available SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-actin prom-dsRed-adra2a.1227.shRNA
Plasmid#67880Purposeexpresses dsRed and shRNA to knock down adra2a receptorsDepositorInsertdsRed and shRNA to knock down the mouse adra2 receptor
UseAAVExpressionMammalianPromoterchicken beta actinAvailable SinceSept. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-flex-iGABASnFR2(no bind)-WPRE
Plasmid#218879PurposeAAV-mediated expression of improved GABA sensor control (no change in fluorescence)DepositorHas ServiceAAV1 and AAV5InsertiGABASnFR2(no bind)
UseAAV and Cre/LoxExpressionMammalianMutationS99A F102G R168PPromoterSynapsinAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-NanoLuc-15aa linker-βarrestin2-no HA-GS linker-TEVp
Plasmid#125235PurposeExpresses SPARK2 NanoLuc-βarrestin2-TEVp (no HA) in mammalian cellsDepositorInsertNanoLuc-15aa linker-βarrestin2-no HA-GS linker-TEVp
UseAAVExpressionMammalianPromoterCMVAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {hCAR}off-{GCaMP6f}on-W3SL
Plasmid#111394PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection), Cre-ON GCaMP6f (ultrasensitive calcium sensor), and W3SL regulatory cassette (for maximize cloning capacity)DepositorInsertsUseAAVTags6xHis, Myc, T7, and XpressExpressionMammalianPromoterhSynapsinAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
AiP1969 - pAAV-AiE2563m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214597PurposeAiE2563m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-Gluc-RMA-IRES-EGFP
Plasmid#189630PurposeExpresses Gluc-RMA and EGFP in the presence of Cre recombinase. Double-floxed Gluc-RMA and EGFP for monitoring Cre-expressing neuronal populations.DepositorInsertsGaussia luciferase fused to Fc
IRES-EGFP
UseAAV, Cre/Lox, and LuciferaseTagsGluc and IgG1 FcExpressionMammalianPromoterIRES and hSynAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-H2B-GFP-2A-oG-WPRE-hGH
Plasmid#74289PurposepAAV vector to express H2B-GFP and oG (optimized Glycoprotein) in a Cre-dependent mannerDepositorInsertH2B-GFP and oG (optimized Glycoprotein)
UseAAVExpressionMammalianMutationchimeric glycoproteinPromoterEf1aAvailable SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
(564) pAAV Alb-AAT KRAB-SadCas9 U6-mPcsk9
Plasmid#163025PurposeExpression of CRISPRi with gRNA against mouse Pcsk9DepositorInsertMammalian codon-optimized SadCas9 (Pcsk9 S. aureus)
UseAAVTagsKRAB, SV40 pA, and myc NLSExpressionMammalianPromoterAlb-AATAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJEP317-pAAV-U6SaCas9gRNA(SapI)-EFS-GFP- KASH-pA
Plasmid#113694PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF Con/Foff hChR2(H134R)-EYFP
Plasmid#55647PurposeCre-on/Flp-off ChR2-EYFP under the short Ef1a promoterDepositorInsertChR2(H134R)-EYFP
UseAAV; Cre on/flp off chr2-eyfpTagsEYFPExpressionMammalianPromoterShort Ef1aAvailable SinceAug. 11, 2014AvailabilityAcademic Institutions and Nonprofits only