We narrowed to 15,826 results for: grna
-
Plasmid#59930PurposegRNA for cleavage at rol-6(su1006) locus in C elegansDepositorInsertrol-6(su1006) gRNA
UseCRISPRTagsExpressionMutationPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDB4282
Plasmid#98701PurposeA plasmid containing the 3' portion of the ura4 marker and the gRNA elements downstream of the target sequence. It serves as the PCR template for generating the gRNA insert in the split-ura4 systemDepositorInsertgRNA PCR template
UseCRISPRTagsExpressionYeastMutationPromoterAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDB4283
Plasmid#98702PurposeA plasmid containing the 3' portion of the bsdMX marker and the gRNA elements downstream of the target sequence. It serves as the PCR template for generating the gRNA insert in the split-bsdMX systemDepositorInsertgRNA PCR template
UseCRISPRTagsExpressionYeastMutationPromoterAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_eGFP_497
Plasmid#111824PurposeKnockout eGFPDepositorInsertgRNA targeting eGFP 477-497
UseCRISPRTagsmCherryExpressionBacterial and MammalianMutationPromoterU6Available SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAH237
Plasmid#121146PurposeExpression of both nmt41p-cas9 and rrk1p-gRNA (LEU2 marker) for CRISPR genome editing in fission yeastDepositorInsertsgRNA cassette
humanized Streptococcus pyogenes Cas9
UseCRISPRTagsFlagExpressionYeastMutationPromoterS.pombe rrk1 and nmt41Available SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAEF5
Plasmid#136305PurposePlasmid encoding the Cas9 gene and a gRNA expression cassette allowing to clone a single or multiple gRNAs for DSBs induction in yeast. Constructed by Aubin FleissDepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationPromoterAvailable SinceFeb. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_eGFP_191
Plasmid#111821PurposeKnockout eGFPDepositorInsertgRNA targeting eGFP 171-191
UseCRISPRTagsmCherryExpressionBacterial and MammalianMutationPromoterU6Available SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
Anep8_Cas9
Plasmid#117169PurposeExpressed Cas9 in Aspergillus with LIC tags for easy gRNA cloningDepositorTypeEmpty backboneUseCRISPR and Synthetic Biology; Filamentous fungi e…TagsExpressionMutationPromoterPkiAvailable SinceJan. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAK005
Plasmid#128218Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 5DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 5
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAK003
Plasmid#128216Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 3DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 3
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAK004
Plasmid#128217Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 4DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 4
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAK006
Plasmid#128219Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 6DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 6
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAK002
Plasmid#128215Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 2DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 2
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAK008
Plasmid#128225Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 2DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 2
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAK009
Plasmid#128226Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 3DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 3
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry-ACTG1
Plasmid#66943PurposeCRISPaint target selector ACTG1DepositorInsertgRNA ACTG1
UseTagsExpressionMutationPromoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry-HIST1H4C
Plasmid#66944PurposeCRISPaint target selector HIST1H4CDepositorInsertgRNA HIST1H4C
UseTagsExpressionMutationPromoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_eGFP_369
Plasmid#111823PurposeKnockout eGFPDepositorInsertgRNA targeting eGFP 349-369
UseCRISPRTagsmCherryExpressionBacterial and MammalianMutationPromoterU6Available SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_eGFP_314
Plasmid#111822PurposeKnockout eGFPDepositorInsertgRNA targeting eGFP 294-314
UseCRISPRTagsmCherryExpressionBacterial and MammalianMutationPromoterU6Available SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJA50
Plasmid#59931PurposegRNA for cleavage at unc-58(e665) locus in C elegansDepositorInsertunc-58(e665) gRNA
UseCRISPRTagsExpressionMutationPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJA59
Plasmid#59932PurposegRNA for cleavage at unc-109(n499) locus in C elegansDepositorInsertunc-109(n499) gRNA
UseCRISPRTagsExpressionMutationPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1.linker_KO
Plasmid#164688PurposeFor CRISPR knockout of miR-144~451 linker region by lentiviral delivery of Cas9 and linker gRNADepositorInsertmiR-144~451 linker CRISPR KO gRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCUX1.1.0-gDNA
Plasmid#112434PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor CUX1DepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJA14
Plasmid#59929PurposegRNA for cleavage at rde-1(H974) locus in C elegansDepositorInsertrde-1(H974) gRNA
UseCRISPRTagsExpressionMutationPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB11785
Plasmid#212699PurposegRNA targeting to the intergradtion site E4DepositorInsertgRNA targeting to the intergradtion site E4
UseTagsExpressionYeastMutationPromoterAvailable SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB10769
Plasmid#212694PurposegRNA targeting to the intergradtion site E2DepositorInsertgRNA targeting to the intergradtion site E2
UseTagsExpressionYeastMutationPromoterAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB12719
Plasmid#212702PurposegRNA targeting to the intergradtion site F3DepositorInsertgRNA targeting to the intergradtion site F3
UseTagsExpressionYeastMutationPromoterAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only