We narrowed to 65,344 results for: %s
-
Plasmid#191578PurposeInducible expression of SARS-CoV-2 Spike protein with C-terminal 3x FLAG tag under TRE3G promoter and cloned into a 2nd generation lentiviral transfer plasmid (modified pLVX with Hygro resistance).DepositorInsertSARS-CoV-2 Spike Protein (S Synthetic)
UseLentiviralTags3x FLAGExpressionMammalianPromoterTRE3GAvailable sinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET11a-AldoA
Plasmid#224925PurposeInducible expression of human aldolase ADepositorAvailable sinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
plenti hSyn GAPDH
Plasmid#220918PurposeNeuronal specific expression of GAPDHDepositorAvailable sinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
LMPd Amt OXCT1
Plasmid#209407PurposeRetroviral vector with Ametrine marker for expressing shRNA with an "UltramiR" microRNA scaffoldDepositorInsertOxct1 shRNA (Oxct1 Mouse)
UseRetroviralAvailable sinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CMV-AID'-seBE4max-IRES
Plasmid#174697PurposeSmall-molecule controlled base editingDepositorInsertAID'-seBE4max-IRES (AICDA Human)
Tagsmyc tagExpressionMammalianMutationUGI-E11KPromoterCMVAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKS022 - pCAGGS-3XFLAG-mKate2-SA2-bpA
Plasmid#156441PurposeFor transient expression of mouse SA2 (STAG2 or SCC3B) tagged with mKate2DepositorAvailable sinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLL3 sgRNA(MS2)-MS2-AID3f
Plasmid#112129Purposeempty sgRNA cloning vector with MS2-AID3fDepositorInsertAIDmono 3f mutant (AICDA Human)
UseCRISPRExpressionMammalianMutationN- mutated and C- terminal truncated, F115Y/C116F…PromoterhU6,CBhAvailable sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PGK1 gRNA (BRDN0001487049)
Plasmid#77981Purpose3rd generation lentiviral gRNA plasmid targeting human PGK1DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PGK1 gRNA (BRDN0001146969)
Plasmid#77982Purpose3rd generation lentiviral gRNA plasmid targeting human PGK1DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NG1237 pCI-TPI-PTC160-4H
Plasmid#65804PurposeNMD reporter mRNADepositorInsertTPI (TPI1 Human)
Tags4H (4 copies of short beta-globin 3'UTR for …ExpressionMammalianMutationpremature stop codon at 160PromoterCMVAvailable sinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRZ241:SSX1p-GAD-EX1-5'D-ID-BD6-S(50bp)
Plasmid#251319PurposeExpression of GAD-EX1 under SSX1p promoter for use in synthetic gene circuitsDepositorInsertGAD-EX1
ExpressionMammalianPromoterSSX1pAvailable sinceApril 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRZ274:SSX1p-mK2-Ex1-ID-AFP BD-S-(linker1)-pA
Plasmid#251321PurposeExpression of mK2-Ex1 under SSX1p promoter for use in synthetic gene circuitsDepositorInsertmK2-Ex1
ExpressionMammalianPromoterSSX1pAvailable sinceApril 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pET28c_S(-31)-M30_dT7term
Plasmid#112253PurposeExpresses the S(-31)-M30 apta-FRET RNA origami structure.DepositorInsertS(-31)-M30 apta-FRET RNA origami with T7 promoter and terminators.
UseSynthetic BiologyExpressionBacterialPromoterT7 promoterAvailable sinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28c_S*5-M5_dT7term
Plasmid#112254PurposeExpresses the S*5-M5 apta-FRET RNA origami structure.DepositorInsertS*5-M5 apta-FRET RNA origami with T7 promoter and terminators.
UseSynthetic BiologyExpressionBacterialPromoterT7 promoterAvailable sinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
mPA-GFP-ER-3
Plasmid#57131PurposeLocalization: Endoplasmic Reticulum, Excitation: 400 / 504, Emission: 515 / 517DepositorAvailable sinceFeb. 5, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223-CDC2
Plasmid#23776DepositorInsertCDC2 (CDK1 Human)
UseGateway CloningAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRZ314:CMVp-mK2-Ex1-(5'D)-ID-BD6-S(50bp)-pA
Plasmid#251323PurposeExpression of mK2-Ex1 under CMVp promoter for use in synthetic gene circuitsDepositorInsertmK2-Ex1
ExpressionMammalianPromoterCMVpAvailable sinceApril 16, 2026AvailabilityAcademic Institutions and Nonprofits only