We narrowed to 11,520 results for: Kars
-
Plasmid#155999PurposeFor use in RBP tethering screenDepositorAvailable SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only
-
OMM-long-CFAST10
Plasmid#233598PurposeExpression of CFAST10 on the OMM membrane after a long linkerDepositorInsertCFAST10
ExpressionMammalianPromoterCMVAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Venus-G protein Beta2 in pcDNA3.1
Plasmid#42182DepositorAvailable SinceJuly 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDY1462_SERPINA1_CCA32_Caspase
Plasmid#193194PurposeExpress Caspase conditional upon RNA transcriptDepositorInsertiCaspase9 (CASP9 Human)
ExpressionMammalianAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
SFG.wtCNa_opt.IRES.eGFP
Plasmid#22489DepositorInsertcodon optimised wild type Calcineurin A (PPP3CA Human)
UseRetroviralMutationCodon Optimised wtCNaAvailable SinceDec. 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
PRPF3
Plasmid#155848PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEFIRES-P-ACSL3-mCherry
Plasmid#87158PurposeFluorescent protein targeted to lipid droplets (LDs) from the endoplasmic reticulum (ER)DepositorAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Flag-cMyc T58A
Plasmid#20075DepositorAvailable SinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
CMV-ER-LAR-GECO1
Plasmid#61244PurposeExpresses LAR-GECO1 in the endoplasmic reticulum in mammalian cellsDepositorInsertLAR-GECO1
TagsER-retention sequence: KDEL and ER-targeting sequ…ExpressionMammalianMutationSubstitutions relative to R-GECO1: V51W/I113V/N35…PromoterCMVAvailable SinceMarch 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-MCS-pA
Plasmid#233031PurposeTo express a DjCas13d-compatible gRNADepositorInsertDjCas13d-compatible gRNA expression cassette
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-P2A-mCherry-pA
Plasmid#233025PurposeTo Express HA tagged CasRX and mcherry from the mammalian EFS promoter. The CasRx and mCherry are separated by a P2A siteDepositorInsertCasRx/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLEGFP-WT-STAT3
Plasmid#71450PurposeRetroviral expression of WT-STAT3. Please note that this plasmid contains WT-STAT3 tagged with FLAG, not GFP.DepositorAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.HaloTag
Plasmid#244094PurposeCytosolic expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.H348H.HaloTag
Plasmid#244095PurposeCytosolic expression of green glucose sensor (high affinity) with non-responsive HaloTagDepositorInsertiGlucoSnFR2.H348H.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251_ Ptrc.x.tetO2::D-HicDH
Plasmid#185456PurposeCDS of D-HicDH codon optimized for expression in Synechocystis sp. PCC 6803 under the control of the synthetic promoter Ptrc.x.tetO2 and the RBS BBa_B0030 in pSEVA251 plasmid.DepositorInsertD-HicDH from Lactobacillus paracasei DSM 20008
ExpressionBacterialPromoterPtrc.x.tetO2Available SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAX198
Plasmid#173042PurposeCustom vector for sgRNA library constructionDepositorInsertHBB Gene - Second and third exons of ENST00000647020.1 (no intron) and part of the 3' UTR (HBB Human)
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
HA-SOCS1
Plasmid#174571PurposeHuman HA-tagged SOCS1 expression (N-term. tag) (CMV prom.)DepositorInsertHA-SOCS1
ExpressionMammalianPromoterCMVAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
SNW1
Plasmid#156034PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCB’ CbbL Y72R
Plasmid#162707PurposeCarboxysome operon with point mutation to CbbL, prk; Substitution of CsoS2-binding tyrosine with arginine prevents rubisco encapsulation creating rubisco-less carboxysomesDepositorInsertpHnCB10 derived carboxysome operon, prk
ExpressionBacterialMutationCbbL Y72R; Substitution of CsoS2-binding tyrosine…PromoterPLtet0-1 promoterAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only