We narrowed to 32,278 results for: ica

#113162

A donor plasmid with homologous arms matching rat Rosa26 and expressing a Cre-dependent FLAG-tagged SpCas9n and a NeoR selectable marker

Brandon Harvey

Back et al Neuron. 2019 Feb 8. pii: S0896-6273(19)3

March 13, 2019

Academic Institutions and Nonprofits only

#101253

Expresses HA-dL5(E52D)-cMyc N-terminal fusion of beta-2 adrenergic receptor in mammalian cells, MMLV retroviral plasmid (MBIC5, dL5**, FAP, ADRB2)

Marcel Bruchez

Perkins et al Biochemistry. 2018 Feb 6;57(5):861-871.

Oct. 9, 2019

Academic Institutions and Nonprofits only

#107544

AAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFP

Hélène Marie

Pousinha et al Elife. 2017 Jul 6;6. doi: 10.7554/eLife.

May 2, 2018

Academic Institutions and Nonprofits only

#113156

An AAV vector that expresses guide RNAs targeting rat Rosa26 and expresses EGFP reporter

Brandon Harvey

Back et al Neuron. 2019 Feb 8. pii: S0896-6273(19)3

March 7, 2019

Academic Institutions and Nonprofits only

#99558

mammalian expression of TMEM230 (isoform 1) and ZsGreen

Han-Xiang Deng

Deng et al Nat Genet. 2016 Jul;48(7):733-9. doi: 10

Aug. 14, 2017

Academic Institutions and Nonprofits only

#246637

Genetically encoded voltage indicator (GEVI) JEDI3hyp in AAV production vector for expression in excitatory glutamatergic neurons using the promoter CaMKIIa

Francois St-Pierre

Land et al Nat Methods. 2026 Apr 15. doi: 10.1038/s

April 23, 2026

Academic Institutions and Nonprofits only

#246638

Soma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI3hyp in AAV production vector for expression in excitatory glutamatergic neurons using the promoter CaMKIIa

Francois St-Pierre

Land et al Nat Methods. 2026 Apr 15. doi: 10.1038/s

April 23, 2026

Academic Institutions and Nonprofits only

#246639

Genetically encoded voltage indicator (GEVI) JEDI3hyp with a 3xGSS linked CyOFP1 expressed under a strong mammalian promoter (CAG)

Francois St-Pierre

Land et al Nat Methods. 2026 Apr 15. doi: 10.1038/s

April 23, 2026

Academic Institutions and Nonprofits only

#246641

Genetically encoded voltage indicator (GEVI) JEDI3hyp with a 3xGSS linked mBeRFP E6F expressed under a strong mammalian promoter (CAG)

Francois St-Pierre

Land et al Nat Methods. 2026 Apr 15. doi: 10.1038/s

April 23, 2026

Academic Institutions and Nonprofits only