We narrowed to 10,928 results for: cat.1
-
Plasmid#186850PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with DNA binding mutantation C396/397A) and C-terminal HA tag (Adamts1 Synthetic, Human)
UseRetroviralTagsHAMutationN-terminal truncation, C396A, C397APromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGAS:154-522aa-HA
Plasmid#186855PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (154-522 a.a.) with C-terminal HA tag (Adamts1 Synthetic, Human)
UseRetroviralTagsHAMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBM019
Plasmid#128179PurposeConstruct for generating stable Cas9-expressing Toxoplasma gondiiDepositorInsertssgRNA#1
SpCas9
Chloramphenicol acetyltransferase
UseCRISPR; Toxoplasma gondii expressionTags3X FLAG and Nuclear Localization SignalPromoterTUB1 (Toxoplasma gondii), U6 (Toxoplasma gondii),…Available SinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
FHp5pUP95C3,5SGW (E5)
Plasmid#74035Purposelentiviral expression of Psd95 shRNA and Psd95-C3,5S-EGFP fusionDepositorInsertPsd95
UseLentiviral and RNAiExpressionMammalianMutationPCR: C3,5S (tct aga cca cca tgg act Ctc tAt CGa t…PromoterH1Available SinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
TFORF3297
Plasmid#144773PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3158
Plasmid#144634PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3296
Plasmid#144772PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (F40-based no force control)
Plasmid#118718PurposeThe donor (YPet(short)) only control for the no force control of the F40-based human desmoplakin II tension sensor provides the donor only lifetime used in lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-F40-mCherry(Y72L)] (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y72L mutation in mCherry…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
ABL1-C-HiBiT
Plasmid#234568PurposeBacterially expressed ABL1-C-HiBiT for Ni-NTA purificationDepositorInsertAbelson Kinase Domain (ABL1 Human)
TagsHiBiT Tag-thrombin site-10xHis and T7 gene 10 lea…ExpressionBacterialMutationCodon optimized for bacterial expressionPromoterT7Available SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (FL-based no force control)
Plasmid#118722PurposeThe donor (YPet(short)) only control for the no force control of the FL-based human desmoplakin II tension sensor provides the donor only lifetime used in lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-FL-mCherry(Y72L)] (DSP Human)
UseRetroviralTagsYPet(short)-FL-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y72L mutation in mCherry…PromoterCMVAvailable SinceDec. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II acceptor only control (F40-based no force control)
Plasmid#118720PurposeThe acceptor (mCherry) only control for the no force control of the F40-based human desmoplakin II tension sensor can be co-expressed with the donor only control to determine intermolecular FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)(Y67G)-F40-mCherry] (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y67G mutation in YPet(sh…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
mP14H1
Plasmid#84369Purposeantigen for mouse PRDM14 purification ( aa 1-231)DepositorInsertPRDM14
Tags6xHisExpressionBacterialMutationonly aa 1-231 presentPromoterT7Available SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL1_41
Plasmid#199048PurposeLevel 1 plasmid, barcoded ORIDepositorInsert2μ ORI plus NGS barcode 18
UseSynthetic BiologyAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL1_39
Plasmid#199046PurposeLevel 1 plasmid, barcoded ORIDepositorInsertpSa ORI plus NGS barcode 16
UseSynthetic BiologyAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL1_37
Plasmid#199044PurposeLevel 1 plasmid, barcoded ORIDepositorInsertRSF1010 ORI plus NGS barcode 14
UseSynthetic BiologyAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL1_4
Plasmid#199036PurposeLevel 1 plasmid, barcoded ORIDepositorInsertpIP501 ORI plus NGS barcode 4
UseSynthetic BiologyAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL1_36
Plasmid#199043PurposeLevel 1 plasmid, barcoded ORIDepositorInsertpBBR1 ORI plus NGS barcode 13
UseSynthetic BiologyAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL1_38
Plasmid#199045PurposeLevel 1 plasmid, barcoded ORIDepositorInsertpIJ101 ORI plus NGS barcode 15
UseSynthetic BiologyAvailable SinceSept. 21, 2023AvailabilityAcademic Institutions and Nonprofits only