We narrowed to 11,185 results for: cat.1
-
Plasmid#186859PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (164-522 a.a.) with C-terminal HA tag (Adamts1 Synthetic, Human)
UseRetroviralTagsHAMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGAS:166-522aa-HA
Plasmid#186860PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (166-522 a.a.) with C-terminal HA tag (Adamts1 Synthetic, Human)
UseRetroviralTagsHAMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-FLAG-human cGASdeltaN-HA
Plasmid#186848PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with N-terminal FLAG and C-terminal HA tag (Adamts1 Synthetic, Human)
UseRetroviralTagsFLAG and HAMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGASdeltaN C396/397A-HA
Plasmid#186850PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with DNA binding mutantation C396/397A) and C-terminal HA tag (Adamts1 Synthetic, Human)
UseRetroviralTagsHAMutationN-terminal truncation, C396A, C397APromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGAS:154-522aa-HA
Plasmid#186855PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (154-522 a.a.) with C-terminal HA tag (Adamts1 Synthetic, Human)
UseRetroviralTagsHAMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-His6-ODC-Ctag
Plasmid#163614PurposeExpresses truncated human Ornithine Decarboxylase in bacterial cells for binding to Ornithine Decarboxylase Antizyme.DepositorAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
SUMO_MT3
Plasmid#200303PurposeBacterial expression plasmids for production of recombinant metallothionein 3 containing N-terminal tags, which can be cleaved later: His-tag for purification and SUMO-tag for better solubilityDepositorAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCM167-Venus-VF-hADAM10(aa1-459)
Plasmid#189559PurposeProtein expression ADAM10 in mammalian cells. Contains prodomain and metalloprotease domain--amino acids 1-459DepositorInserttruncated ADAM metallopeptidase domain 10 (ADAM10 Human)
TagsVFExpressionMammalianMutationcontains aa 1-459Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-V5-DEST-hADAM10(aa1-213)-GST
Plasmid#189562PurposeProtein expression ADAM10 in mammalian cells. Contains only prodomain--amino acids 1-213DepositorInserttruncated ADAM metallopeptidase domain 10 (ADAM10 Human)
TagsGSTExpressionMammalianMutationcontains aa 1-213Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Bambi NGFR
Plasmid#44628DepositorAvailable SinceApril 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS2
Plasmid#174302PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #2 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS3
Plasmid#174303PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #3 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP5EG3
Plasmid#185878PurposeA plasmid for in vivo gene amplification (HamAmp) at SEC23 locus (1 copy reference)DepositorTypeEmpty backboneExpressionYeastMutationNoneAvailable SinceSept. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP3A5C
Plasmid#185872PurposeA plasmid for in vivo gene amplification (HamAmp) at RPL25 locus (1 copy reference)DepositorTypeEmpty backboneExpressionYeastMutationNoneAvailable SinceSept. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF3296
Plasmid#144772PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3297
Plasmid#144773PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3158
Plasmid#144634PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (F40-based no force control)
Plasmid#118718PurposeThe donor (YPet(short)) only control for the no force control of the F40-based human desmoplakin II tension sensor provides the donor only lifetime used in lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-F40-mCherry(Y72L)] (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y72L mutation in mCherry…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only