We narrowed to 5,049 results for: mos
-
Plasmid#227164PurposeFor T-REX experiments of CYP2A6 C14A, C82A, and C439A triple mutant. Almost no sensing ability to reactive electrophilic species (RES).DepositorInsertCYP2A6 (CYP2A6 Human)
TagsFlag, HaloTag, and His6ExpressionMammalianMutationchanged cysteine 14, cysteine 82, and cysteine 43…PromoterCMV and SP6Available SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC18 Apln5-HA-FlpO-pA-LoxP-PGK-Neo-pA-LoxP-Apln3 (SO89)
Plasmid#159222PurposeCan be used to target the mouse Apln locus in mouse eggs or ES cells, in order to drive the mosaic expression of the protein HA-NLS-FlpODepositorInsertApln 5'-FlpO-WPRE-Sv40pA-LoxP-PGK-Neo-pA-LoxP-Apln
ExpressionMammalianPromoterAplnAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Bod1l_Anti-Sense
Plasmid#124444PurposePlasmid for anti-sense in situ probe in vitro transcriptionDepositorInsertBiorientation of chromosomes in cell division 1-like (Bod1l Mouse)
UseIn situ probePromoterT7Available SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET-28a(+)-FGF2-G3
Plasmid#135521PurposeEngineered form of fibroblast growth factor 2 with improved thermostabilityDepositorInsertfibroblast growth factor 2 (FGF2 Human)
Tags6x His tag and Agg Thrombin TagExpressionBacterialMutationCodon optimized for E. Coli productionPromoterT7 PromoterAvailable SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
WT (DVD)
Plasmid#184316PurposeTo study dynamics of G-actin using NMR spectroscopy.DepositorAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-Myo10
Plasmid#135403PurposeExpresses GFP-tagged bovine Myo10 in mammalian cells.DepositorInsertMyo10 (MYO10 Bovine)
TagsEGFPExpressionMammalianMutation"Relative to the GenBank Myo10 cDNA sequence…PromoterCMVAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
EF1a_Puro_Telo_v2
Plasmid#195139Purpose~100 repeats of the human telomere seed sequence fused to the puromycin resistance gene; digest with BstZ17I-HF and KpnI-HF to obtain transfectable construct for chromosomal arm loss inductionDepositorInsertTelomere (RTEL1 Human)
ExpressionMammalianAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PHFF-sh-hBVRA
Plasmid#100285PurposeExpression vector for phycocyanobilin (PCB) synthesis and shRNA for human BVRA gene in mammalian cellsDepositorInsertsMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
shRNA for human BVRA
TagsFLAG, T7 and Mitochondria-targeting sequence (MTS…ExpressionMammalianMutationAll genes are codon-optimized for expression in h…PromoterCAG promoter and H1 promoterAvailable SinceSept. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
EF1a_Puro_Telo_v1
Plasmid#195138Purpose~100 repeats of the human telomere seed sequence fused to the puromycin resistance gene; digest with BstZ17I-HF and KpnI-HF to obtain transfectable construct for chromosomal arm loss inductionDepositorInsertTelomere (RTEL1 Human)
ExpressionMammalianAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRI003-pGEM-LS-Bar-PgpdA-dSpCas9-VPR-TtrpC-LS
Plasmid#140196PurposeChromosomal integration of PgpdA-dSpCas9-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi vector.DepositorInsertsdSpCas9-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta) , NLSPromoterPgpdA and PtrpCAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
B2M Bulldozer (gRNA crB2M_13)
Plasmid#84381PurposeThis plasmid expresses a gRNA targeting the first exon of human B2M. Most efficient gRNA targeting B2M, leading to ablation of B2M and MHC class I surface expression in 50% of transfected cellsDepositorInsertB2M Bulldozer crB2M_13 gRNA
ExpressionMammalianPromoterhU6 promoterAvailable SinceJuly 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PHFF-sh-mBVRA
Plasmid#100286PurposeExpression vector for phycocyanobilin (PCB) synthesis and shRNA for mouse BVRA gene in mammalian cellsDepositorInsertsMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
shRNA for mouse BVRA
TagsFLAG, T7 and Mitochondria-targeting sequence (MTS…ExpressionMammalianMutationAll genes are codon-optimized for expression in h…PromoterCAG promoter and H1 promoterAvailable SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWZ194
Plasmid#163640Purposerps-27>DHB::2xmKate2-P2A-H2B::GFP expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome IDepositorInsertDHB::2mKate2-P2A-H2B::GFP::3xHA (his-58 Nematode, Synthetic)
UseCRISPRTags2xmKate2 and GFPExpressionWormPromoterrps-27Available SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTH734-2µ-RLuc/stopCFLuc
Plasmid#40609DepositorInsertsFirefly Luciferase (nonsense mutant)
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAWK61
Plasmid#163642Purposerps-27>DHB::GFP-P2A-H2B::2xmKate2 expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome IDepositorInsertDHB::GFP-P2A-H2B::2xmKate2::3xHA (his-58 Nematode, Human)
UseCRISPRTags2xmKate2 and GFPExpressionWormPromoterrps-27Available SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTH752-CEN-RLuc/min103maxCFLuc
Plasmid#38218DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 103 codons of the original FLuc gene we…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH751-CEN-RLuc/min53maxCFLuc
Plasmid#38217DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 53 codons of the original FLuc gene wer…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCAG-HP1γ-ΔCSD-EGFP
Plasmid#179934PurposeC terminal fusion of EGFP to mouse HP1γ (Cbx3) containing deletion of entire chromoshadow domain (ΔCSD)DepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -