We narrowed to 13,056 results for: BASE
-
Plasmid#49790PurposeFRET-based, Golgi-targeted kinase activity reporter for PKDDepositorInsertD kinase activity reporter
TagsCFP, YFP, and eNOS(1-33)ExpressionMammalianPromoterCMVAvailable SinceJan. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6-MRPS6-VN172
Plasmid#182374PurposemVenus-based mito-riboBiFC vectorDepositorAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB2375
Plasmid#67546PurposeEasyClone system-based yeast integrative vector carrying loxP-flanked natMX marker, integration into S. cerevisiae XI-1 chromosomal location, USER site for cloning, amp resistanceDepositorTypeEmpty backboneUseCre/Lox; IntegrativeExpressionYeastAvailable SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB2374
Plasmid#67534PurposeEasyClone system-based yeast integrative vector carrying loxP-flanked KlURA3 marker, integration into S. cerevisiae XI-1 chromosomal location, USER site for cloning, amp resistanceDepositorTypeEmpty backboneUseCre/Lox; IntegrativeExpressionYeastAvailable SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVH234-Tier1-PmPGK1-tTA
Plasmid#169574PurposeTier-1 vector encoding PmPGK1-driven tTA expression (PmPGK1-tTA-pA).DepositorInserttetracycline-controlled transactivator
ExpressionMammalianPromoterPPGKAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDest490-OPN-NT
Plasmid#17594DepositorAvailable SinceMarch 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCfB2192
Plasmid#67539PurposeEasyClone system-based yeast integrative vector carrying loxP-flanked KlLEU2 marker, integration into S. cerevisiae XII-2 chromosomal location, USER site for cloning, amp resistanceDepositorTypeEmpty backboneUseCre/Lox; IntegrativeExpressionYeastAvailable SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTC208
Plasmid#70017PurposeTALENs targeting ANT1 locus, donor molecule with 5' homology arm-Pnos:NptII-35S:ANT13' homology arm as a Gemini Viral Replicon based onTomato Yellow Leaf Curl VirusDepositorInsertNuclease (TALENs) + Donor + GVR
UseTALENExpressionPlantAvailable SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB2513
Plasmid#67543PurposeEasyClone system-based yeast integrative vector carrying loxP-flanked hphMX marker, integration into S. cerevisiae X-2 chromosomal location, USER site for cloning, amp resistanceDepositorTypeEmpty backboneUseCre/Lox; IntegrativeExpressionYeastAvailable SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDest490-OPN-10 kDa
Plasmid#17595DepositorAvailable SinceMarch 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
pDest490-OPN-CT
Plasmid#17593DepositorAvailable SinceMarch 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
DCX 3UTRm3hp
Plasmid#28302DepositorInsertDoublecortin 3' Untranslated region mutated
ExpressionMammalianMutation3 base pair mutation in DCX 3'UTR regionAvailable SinceMay 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCfB2400
Plasmid#67552PurposeEasyClone system-based yeast integrative vector carrying loxP-flanked dsdA marker, integration into S. cerevisiae XII-1 chromosomal location, USER site for cloning, amp resistanceDepositorTypeEmpty backboneUseCre/Lox; IntegrativeExpressionYeastAvailable SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
circRAJ31-Toehold_mutant
Plasmid#69930PurposeExpresses a toehold mutant of the circRAJ31 riboregulator encased in a permuted intron exon ribozyme, which circularises the riboregulator. This mutant does not activate cisRAJ31.DepositorInsertplTet-circRAJ31_toeholdmutant
UseSynthetic BiologyMutation4 bases mutated in toehold of riboregulatorPromoterPltetO1-2Available SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB2198
Plasmid#67554PurposeEasyClone system-based yeast integrative vector carrying loxP-flanked hphMX marker, integration into S. cerevisiae XII-4 chromosomal location, USER site for cloning, amp resistanceDepositorTypeEmpty backboneUseCre/Lox; IntegrativeExpressionYeastAvailable SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB2228
Plasmid#67540PurposeEasyClone system-based yeast integrative vector carrying loxP-flanked SpHIS5 marker, integration into S. cerevisiae XII-4 chromosomal location, USER site for cloning, amp resistanceDepositorTypeEmpty backboneUseCre/Lox; IntegrativeExpressionYeastAvailable SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRL1058
Plasmid#70686PurposeTn5-based plasmid for transposition in Anabaena sp. strain PCC 7120. Bears an oriV, so when excised from a chromosome or megaplasmid it can carry its neighboring sequences when returned to E. coli.DepositorInsertTransposon Tn5-1058
Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
R26_CAG_BST_FUCCIplex
Plasmid#240241PurposeROSA26 knock-in vector with homology-mediated end joining(HMEJ)-based method. The CAG promoter drives the expression of the FUCCIplex sensor.DepositorInsertFUCCIplex
ExpressionMammalianPromoterCAGAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET29b_cpCys203
Plasmid#247771Purposebacterial expression of cpCys203 FRET-based cysteine sensorDepositorInsertcpCys203 Cysteine Sensor
TagsECFP and Venus and His6-TEVExpressionBacterialAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAWP78-PVCpnf_pvc13-Ad5_pvc8-Cas9
Plasmid#243737PurposePVC structural operon - tail fiber (Pvc13) retargeted with Ad5 knob - spike base (Pvc8) loaded with Cas9 on CTDDepositorInsertpvc13-Ad5_pvc8-Cas9
ExpressionBacterialAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB027
Plasmid#234636PurposepET-28a(+) based plasmid for expression of H16_B1102 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB028
Plasmid#234637PurposepET-28a(+) based plasmid for expression of H16_B1148 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB029
Plasmid#234638PurposepET-28a(+) based plasmid for expression of H16_B1264 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB030
Plasmid#234639PurposepET-28a(+) based plasmid for expression of H16_B1335 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB026
Plasmid#234635PurposepET-28a(+) based plasmid for expression of H16_A3514 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGlomyc-Grhl1 (618 aa)
Plasmid#236049PurposeMammalian expression vector with myc-tagged mouse Grhl1 coding sequence (long isoform)DepositorAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB.DEST-Illusia
Plasmid#215444PurposePiggybac expression vector with Illusia FRET reporter for integrin phosphorylationDepositorInsertIllusia
UseTransposon-based stable expressionExpressionMammalianPromoterCAGAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCI5-CasRx-NLS-HA (pKW919)
Plasmid#229047PurposeMammalian expression of CasRx-NLS-HADepositorInsertCasRx (RfxCas13d)
UseCRISPRTagsNLS and NLS-HAExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vector 1174K
Plasmid#221017PurposeFluorescent based sex separator in Anopheles species mosquitoes (SEPARATOR)DepositorInsertEngineered dobulesex splicing module (Anopheles gambiae)
UseSynthetic BiologyExpressionInsectAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only