We narrowed to 5,500 results for: crispr cas9 grna plasmid
-
Plasmid#74370PurposeThis plasmid constitutively expresses gRNA-r10 from an AHD1 promoter using the RGR design. Integrates in the W303 HIS locus and restores HIS function.DepositorArticleInsertRGR-r10
UseCRISPR and Synthetic BiologyExpressionYeastPromoterADH1Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMOD8A-iRGR-r11
Plasmid#74369PurposeThis plasmid constitutively expresses gRNA-r11 from an AHD1 promoter using the insulated RGR design. Integrates in the W303 HIS locus and restores HIS function.DepositorArticleInsertRGR-r11
UseCRISPR and Synthetic BiologyExpressionYeastPromoterAHD1Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
ampl43
Plasmid#161830PurposepRS416-dCas9-Mxi1+TetR+pRPR1(TetO)-NotI-gRNA plasmid marked with His, expressing dCas9-Mxi1 under Tef1 promoter, and a tet-inducible promoter for gRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionYeastPromoterTEF1Available SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBHM2681
Plasmid#241726PurposeConstruction of fused marker-sgRNA inserts for Cryptococcus neoformans genome editing, contains ptxD marker for selection on media containing phosphite as a sole phosphorus sourceDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSP571
Plasmid#139498PurposeCRISPR-Cas9 plasmid to generate double strand break in STL1 locus in S. cerevisiae. Expresses both Cas9 and STL1 sgRNADepositorInsertpGPD Cas9 / sgRNA (STL162)
ExpressionYeastMutationWTPromoterpGPDAvailable SinceJune 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV495
Plasmid#177702PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAaGCAGATTAAtGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SRC1p (Debaryomyc…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSP2292
Plasmid#70707PurposeBacterial expression plasmid for KKH SaCas9 & sgRNA targeted to site 2: T7-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized KKH variant Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationE782K, N968K and R1015H in SaCas9PromoterT7Available SinceDec. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP2253
Plasmid#70704PurposeBacterial expression plasmid for KKH SaCas9 & sgRNA targeted to site 1: T7-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized KKH variant Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationE782K, N968K and R1015H in SaCas9PromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
sg1+sg2+sg3
Plasmid#113969PurposeTriple short guide RNA targeting GTATAGCATACATTATACG, TACCACATTTGTAGAGGTT & CAATGTATCTTATCATGTCDepositorInsertsg1+sg2+sg3
ExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCB-CBEv1
Plasmid#221138PurposeCoxiella burnetii CRISPR-Cas9 cytosine base editing plasmid version 1 without sgRNA construct. Expresses 3xF-HF-BE3.DepositorInsert3xF-rAPOBEC1-Cas9n(HF)-UGI (HF-BE3)
UseCRISPRTags3xFLAGExpressionBacterialPromoterlacIq-PtacAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCB-CBEv2
Plasmid#221139PurposeCoxiella burnetii CRISPR-Cas9 cytosine base editing plasmid version 2 without sgRNA construct. Expresses 3xF-BE4-PpAPOBEC1(H122A).DepositorInsert3xF-PpAPOBEC1(H122A)-Cas9n-UGI-UGI (BE4-PpAPOBEC1(H122A))
UseCRISPRTags3xFLAGExpressionBacterialPromoterlacIq-PtacAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_SYCP3_nterm
Plasmid#222524PurposeCas9/sgRNA plasmid for targeting SYCP3DepositorInsertCas9, SYCP3 sgRNA (SYCP3 Human, Synthetic)
UseCRISPRAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-sgCTG-SlugD10A-3XFLAG-SV40 NLS-ITR2
Plasmid#222857PurposeThis plasmid codes for the Slug-KH nickase with a sg(CTG)6DepositorInsertSlug-KHD10A+sgCTG
UseCRISPRTags3X FLAG, SV40 NLS, ITR2 and ITR2ExpressionMammalianMutationKH variant and D10A mutationPromoterH1 and eCMVAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-sgAGC-SlugD10A-3XFLAG-SV40 NLS-ITR2
Plasmid#222859PurposeThis plasmid codes for the Slug-KH nickase with a sg(AGC)6DepositorInsertSlug-KHD10A+sgAGC
UseCRISPRTags3X FLAG, SV40 NLS, ITR2 and ITR2ExpressionMammalianMutationKH variant and D10A mutationPromoterH1 and eCMVAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only