We narrowed to 5,500 results for: crispr cas9 grna plasmid
-
Plasmid#222858PurposeThis plasmid codes for the Slug-KH nickase with a sg(CAG)6DepositorInsertSlug-KHD10A+sgCAG
UseCRISPRTags3X FLAG, SV40 NLS, ITR2 and ITR2ExpressionMammalianMutationKH variant and D10A mutationPromoterH1 and eCMVAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-sgGCA-SlugD10A-3XFLAG-SV40 NLS-ITR2
Plasmid#222860PurposeThis plasmid codes for the Slug-KH nickase with a sg(GCA)6DepositorInsertSlug-KHD10A+sgGCA
UseCRISPRTags3X FLAG, SV40 NLS, ITR2 and ITR2ExpressionMammalianMutationKH variant and D10A mutationPromoterH1 and eCMVAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pFH6
Plasmid#86555PurposeSubcloning of any sgRNA via BbsI sites. Note that there is an improved version of this plasmid (Addgene 105866) that results in up to 10x greater efficiencyDepositorInsertU6-26p::sgRNA scaffold
UseCRISPR; SubcloningPromoterArabidopsis U6-26 promoterAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRBPJ.1.0-gDNA
Plasmid#132474PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertRBPJ (RBPJ Human)
UseCRISPRAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEN-L1-PJ23119-PplpT-sfGFP-TrrfB-BsaI-Scaf-L2
Plasmid#196250PurposePlasmid for cloning of a CRISPR-Cas9 guide RNA gene under promoter PJ23119DepositorInsertattL1-GlpT-scGFP-attL2
ExpressionBacterialPromoterJ23119 promoterAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKM808
Plasmid#134181PurposeLentiviral sgRNA plasmid with blasticidin resistanceDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-VPR
Plasmid#68498Purposenuclease competent ST1-Cas9 fused to VPRDepositorInsertST-Cas9-VPR
TagsVPRExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRISPomyces-2BD
Plasmid#234428PurposePlasmid for Streptomyces containing gene of modified Cas9-BD protein and sequence of sgRNA cloning templateDepositorInsertModified Cas9 with polyaspartate linking
ExpressionBacterialMutationLinked polyaspartate using glycine-serine linkerAvailable SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAT-9208
Plasmid#124221PurposeCloning plasmid for a self-targeting gRNA libraryDepositorInsertself-targeting gRNA
UseCRISPRExpressionBacterialPromoterJ23119Available SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAT-9222
Plasmid#124222PurposeCloning plasmid for EGxFP assay with self-targeting gRNA-sDepositorInsertself-targeting gRNA between EGFP halves
UseCRISPRExpressionMammalianPromoterCAGAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
v3em-Cterm-PE2max-∆RNaseH-dualU6
Plasmid#198735PurposeAAV genome encoding C-terminal PE2max and U6 expression cassettesDepositorInsertNpuC-CtermPE2max∆RNaseH
UseAAVPromoterCbhAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pV1093
Plasmid#111428PurposeCaCas9/gRNA Solo entry plasmid for cloning guides - contains stuffer with BsmBI sites - integrates at ENO1DepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX300A-G+Nanog
Plasmid#140280PurposeCRISPR/Cas9 plasmid encoding Cas9 and sgRNA against gBait and Nanog locusDepositorInsertCas9
ExpressionMammalianPromoterCBHAvailable SinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
RFN_EGFP_81
Plasmid#60073PurposeExpresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nucleaseDepositorInsertpair of multiplex gRNAs targeting EGFP
UseCRISPRExpressionMammalianPromoterU6Available SinceOct. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
RFN_EGFP_47
Plasmid#60071PurposeExpresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nucleaseDepositorInsertpair of multiplex gRNAs targeting EGFP
UseCRISPRExpressionMammalianPromoterU6Available SinceOct. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
RFN_EGFP_84
Plasmid#60076PurposeExpresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nucleaseDepositorInsertpair of multiplex gRNAs targeting EGFP
UseCRISPRExpressionMammalianPromoterU6Available SinceOct. 16, 2014AvailabilityAcademic Institutions and Nonprofits only