We narrowed to 5,362 results for: crispr cas9 grna plasmid
-
Plasmid#164967PurposeExpresses sgRNA in mammalian cellsDepositorInserthU6-sgCry1_2-hU6-sgCry2_1-hU6-sgCry2_2
UseAAVTagsmCherryPromoterhU6, hSynAvailable SinceMay 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX552-hsyn DIO GCaMP8f(with gRNA scaffold)
Plasmid#199580PurposeExpresses GCaMP8f in a Cre-dependent mannerDepositorInsertHis-DIO GCaMP8f
UseAAV, CRISPR, and Cre/LoxTags6xHisExpressionMammalianPromoterhsynAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX552-EF1a-DIO-mcherry(with gRNA scaffold)
Plasmid#199581PurposeExpresses mCherry in a Cre-dependent mannerDepositorInsertmCherry
UseAAV, CRISPR, and Cre/LoxExpressionMammalianPromoterEF1a intron A and U6Available SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern/EGFP
Plasmid#179913PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato90/816
Plasmid#179918PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 90 and 816.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
CSAC-Bmal1
Plasmid#168296PurposeExpresses sgRNA in mammalian cellsDepositorInserthU6-sgBmal1-1-hU6-sgBmal1-3
UseAAVTagsmCherryPromoterU6, hSynAvailable SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEdit
Plasmid#232355PurposeThe pEdit series plasmids are derived from the pTarget series plasmids by inserting homologous recombination arms targeting the gene of interest, which enables gene knockout or gene insertion at the tDepositorInsertsgRNA
UseCRISPRAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX458-sgRNA_Ago1_4
Plasmid#73536PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago1DepositorInsertAGO1
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-N1303K-ngRNA+14_EF1a-puroR
Plasmid#207359PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of N1303K-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertN1303K-CFTR +14 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmZBP1#1
Plasmid#208387PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ZBP1#1 gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmZBP1#2
Plasmid#208388PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ZBP1#2 gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPSG804
Plasmid#239534PurposeCRISPR plasmid with Cas9 and sgRNA targeting YDR514C locus in S. cerevisiaeDepositorInsertsgRNA_YDR514C
UseCRISPRAvailable SinceJuly 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPSG803
Plasmid#239533PurposeCRISPR plasmid with Cas9 and sgRNA targeting YMR206W locus in S. cerevisiaeDepositorInsertsgRNA_YMR206W
UseCRISPRAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti sgRNA NGFR CFP out of frame
Plasmid#155283PurposeLentiviral plasmid for sgRNA, NGFR marker, editing detected with CFP, used with 155280DepositorTypeEmpty backboneAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-Agrp-(mouse)-MS2gRNA-hSyn-MCP-MSN
Plasmid#210709PurposeThis Plasmid express U6 promoter driven SpdCas9 specific gRNA and hSyn promoter driven MCP-MSN transactivation moduleDepositorInsertSpdCas9 specific Agrp (mouse) MS2gRNA and MCP-MSN
UseAAV and CRISPRExpressionMammalianMutationN55K in MCPPromoterU6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-NPM1-gRNA for HCT116
Plasmid#238249PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to NPM1 locusDepositorInsertNPM1
UseCRISPRAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-CENPA
Plasmid#227282PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of CENPA for knock-in.DepositorInsertsgRNA Targeting N-terminus of CENPA (CENPA Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only