We narrowed to 5,461 results for: pAAV
-
Plasmid#220601PurposeCre-dependent expression of a single-cell discriminating version of EGFP fluorescent proteinDepositorInsertEGFP
UseAAV and Cre/LoxTagsArgiNLSExpressionMammalianPromoterCAGAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GCaMP6f-WPRE
Plasmid#216275PurposeAAV vector with hSynapsin promoter and DIO Lox sites for Cre-On expression of green fluorescent calcium indicator GCaMP6fDepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressPromoterhuman Synapsin 1 (hSyn)Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgFAAH
Plasmid#209197PurposeMutagenesis of FaahDepositorAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgKcnma1
Plasmid#209199PurposeMutagenesis of Kcnma1DepositorAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB_g5-HT2h
Plasmid#208715PurposeExpresses the green 5-HT sensor GRAB_g5-HT2h in neurons in the presence of Cre recombinaseDepositorInsertGreen fluorescent 5-HT sensor GRAB_g5-HT2h
UseAAVPromoterhSynAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-BR1-P2A-FusionRed
Plasmid#192819PurposeExpresses BR1 with FusionRed tag in mammalian cellsDepositorInsertBR1 (BRI1 Mustard Weed)
UseAAVTagsFusionRedExpressionMammalianPromoterchicken β-actin promoterAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hPhyB621(Y276H)-P2A-m1V
Plasmid#197377PurposeThe AAV vector for PhyB621(Y276H) and m1VDepositorInsertPhytochrome B Y276H(1-621 aa)
UseAAVTagsP2A-m1VMutationHuman codon optimized PhyB (1-621 aa), Y276H muta…PromoterCMVAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-mRhubarb713-P2A-GFP
Plasmid#197172PurposeExpresses the protein of mRhubarb713-P2A-GFP in mammalian cellsDepositorInsertmRhubard713-P2A-GFP
UseAAVAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-miRFP2-P2A-GFP
Plasmid#197155PurposeExpresses the protein of miRFP2-P2A-GFP in mammalian cellsDepositorInsertmiRFP2-P2A-GFP
UseAAVAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only