We narrowed to 1,308 results for: grna cloning vector
-
Plasmid#158316PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.V5.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.V5.NWS_NGFR
Plasmid#158317PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.V5.NWSMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.V5.HA_NGFR
Plasmid#158318PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.V5.HAMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.AU1.V5_NGFR
Plasmid#158319PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.AU1.V5MutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.V5.VSVg_NGFR
Plasmid#158320PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.V5.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.Ollas.FLAG_NGFR
Plasmid#158323PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsAU1.Ollas.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.Ollas.NWS_NGFR
Plasmid#158326PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsAU1.Ollas.NWSMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.Ollas.HA_NGFR
Plasmid#158328PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsAU1.Ollas.HAMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.Ollas.VSVg_NGFR
Plasmid#158330PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsAU1.Ollas.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.AU1.C_NGFR
Plasmid#158286PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.AU1.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.V5.FLAG_NGFR
Plasmid#158288PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.V5.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.V5.NWS_NGFR
Plasmid#158289PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.V5.NWSMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.V5.HA_NGFR
Plasmid#158290PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.V5.HAMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.AU1.V5_NGFR
Plasmid#158291PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.AU1.V5MutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.V5.VSVg_NGFR
Plasmid#158292PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.V5.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.AU1.FLAG_NGFR
Plasmid#158295PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.AU1.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.AU1.NWS_NGFR
Plasmid#158298PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.AU1.NWSMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.AU1.HA_NGFR
Plasmid#158300PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.AU1.HAMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.AU1.VSVg_NGFR
Plasmid#158302PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.AU1.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Tag.V5.S.Ollas_NGFR
Plasmid#158304PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsTag.V5.S.OllasMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Tag.AU1.S.Ollas_NGFR
Plasmid#158308PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsTag.AU1.S.OllasMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.V5.C_NGFR
Plasmid#158262PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.V5.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.V5.C_NGFR
Plasmid#158264PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.V5.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.VSVg.C_NGFR
Plasmid#158266PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.VSVg.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.AU1.Ollas_NGFR
Plasmid#158273PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.AU1.OllasMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.AU1.FLAG_NGFR
Plasmid#158238PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.AU1.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.FLAG.VSVg_NGFR
Plasmid#158242PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsAU1.FLAG.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_FLAG.AU1.C_NGFR
Plasmid#158252PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsFLAG.AU1.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.AU1.C_NGFR
Plasmid#158253PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.AU1.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.AU1.C_NGFR
Plasmid#158254PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.AU1.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.AU1.C_NGFR
Plasmid#158255PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.AU1.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_VSVg.AU1.C_NGFR
Plasmid#158256PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsVSVg.AU1.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_FLAG.V5.C_NGFR
Plasmid#158259PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsFLAG.V5.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.AU1.NWS_NGFR
Plasmid#158234PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.AU1.NWSMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.AU1.FLAG_NGFR
Plasmid#158236PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.AU1.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.AU1.V5_NGFR
Plasmid#158237PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.AU1.V5MutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-BPTF-sh3
Plasmid#73667PurposepSIREN-RetroQ vector containing shRNA sequence to BPTFDepositorAvailable SinceMarch 22, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
nAPEX2-V5-zdCas9n-3x-FLAG-GSG-linker-P2A-mNeongreen
Plasmid#241191PurposeMiddle entry vector for mini-Golden subcloning platform; 3x-FLAG; mNeongreenDepositorInsert3x-FLAG; mNeongreen
UseMini-goldenMutationTCGC linkerAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
3x-FLAG-nzdCas9-V5-APEX2n-GSG-linker-P2A-mNeongreen
Plasmid#241190PurposeMiddle entry vector for mini-Golden subcloning platform; V5-APEX2n; mNeongreenDepositorInsertV5-APEX2n; mNeongreen
UseMini-goldenMutationTCGC linkerAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMS73
Plasmid#110629PurposeCRISPR/Cas9 vector for mutliplexed genome editing in Ustilago maydis. Expresses U. maydis codon-optimized Cas9 under the hsp70 promoter, contains a short version of U6 promoter, is self-replicatingDepositorInsertsshort U6 promoter
cas9
tnos terminator
UseCRISPR; Self-replicating in ustilago maydis, conf…TagsN-terminal NLS, C-terminal HA-tag +NLSExpressionBacterialMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU. maydis hsp70 promoter (Kronstad and Leong, 198…Available SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UC-Cas9-T2A-mCherry
Plasmid#135014PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to C-terminus of Cas9, linked to mCherry via a T2A peptideDepositorInserthumanized S. pyogenes Cas9
Tags3x Flag, 3xFLAG (N terminal on insert), NLS, and …ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the C-termi…PromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UN-Cas9-T2A-mCherry
Plasmid#135013PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9, linked to mCherry via a T2A peptideDepositorInserthumanized S. pyogenes Cas9
Tags3x Flag, 3xFLAG (N terminal on insert), NLS, and …ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the N-termi…PromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN527 - Rad21-AID[71-114]-eGFP-FRT-Blast-FRT targeting construct
Plasmid#156452PurposeTargeting vector to introduce an AID-eGFP cassette at the mouse RAD21 (SCC1) locus using BLASTICIDIN selection. Auxin-inducible degron system. Designed to be used with sgRNA CCACGGTTCCATATTATCTGDepositorAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN487 - Sororin-AID[71-114]-eGFP-FRT-Blast-FRT targeting conuct
Plasmid#156433PurposeTargeting vector to introduce an AID-eGFP cassette at the mouse Cdca5 (SORORIN) locus using BLASTICIDIN selection. Auxin-inducible degron system. Designed to be used with sgRNA GGGATGCCCGTCATTAAGTGDepositorAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTij_sg_mmu_Med6_C_terminal
Plasmid#197869PurposeCRISPR/Cas9/sgRNA plasmid for cutting Med6 C terminal and building MED6-mEmerald/Halo knock-in mESCsDepositorAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTij_sg_mmu_Med1_N_terminal
Plasmid#197870PurposeCRISPR/Cas9/sgRNA plasmid for cutting Med1 N terminal and building mEmerald/Halo-MED1 knock-in mESCsDepositorAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCBh-NLS_hfCas13d(RfxCas13d_N2V8)_HA_NLS-pA-U6-DR-BpiI-BpiI-pSV40-EGFP-pA-pSV40-mCherry-pA
Plasmid#190034Purposevector for encoding a human codon-optimized High-fidelity RfxCas13d (hfCas13d) driven by CBh promoter, guide RNAs compatible with RfxCas13d driven by hU6, EGFP and mCherry driven by SV40 promotersDepositorInserthumanized hfCas13d
ExpressionMammalianMutationA134V,A140V,A141V,A143VPromoterCBh, SV40, hU6Available SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only