We narrowed to 4,162 results for: 272
-
Plasmid#227272PurposeExpresses SpCas9 and a sgRNA targeting the AAVS1 loci for knock-in.DepositorAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only
-
-
289aa Met133, 138, 186Ileu ELL2
Plasmid#127272PurposeExpresses 289aa human ELL2 with Met133, 138, 186IleuDepositorInsertELL2 w Met to ILeus stopped at XbaI (ELL2 Human)
ExpressionMammalianMutationMet133, 138, 186 Ileu, cut with XbaI blunt fillinPromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
Myc var1 K51/52 to NQ
Plasmid#127287PurposeExpresses Myc with putative Ub site mutatedDepositorInsertMyc (NM_001177352) (Myc Mouse)
ExpressionMammalianMutationK51 and 52 to N and Q by Q5 mutagenesisPromoterCMVAvailable SinceNov. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
Myc var1 K397R
Plasmid#127285PurposeExpresses Myc with putative Ub site mutatedDepositorInsertMyc (NM_001177352) (Myc Mouse)
ExpressionMammalianMutationK397R by Q5 mutagenesisPromoterCMVAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
Myc var 1 K396/397 to NQ
Plasmid#127286PurposeExpresses Myc with putative Ub site mutatedDepositorInsertMyc (NM_001177352) (Myc Mouse)
ExpressionMammalianMutationK396 and 397 to N and Q by Q5 mutagenesiPromoterCMVAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-Ef1a-Puro-mScarlet
Plasmid#227274PurposeAAVS1 targeting donor for the insertion of Puro and a strong EF1a promoter expressing mScarlet. To be co-transfected with sgRNA plasmid px330-AAVS1 (Addgene #227272)DepositorInsertAAVS1 Homology Arms flanking a 2A-Puro-EF1a-mScarlet cassette (AAVS1 Synthetic)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-Ef1a-Puro-moxGFP
Plasmid#227273PurposeAAVS1 targeting donor for the insertion of Puro and a strong EF1a promoter expressing moxGFP. To be co-transfected with sgRNA plasmid px330-AAVS1 (Addgene #227272)DepositorInsertAAVS1 Homology Arms flanking a 2A-Puro-EF1a-moxGFP cassette (AAVS1 Synthetic)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+DPP6
Plasmid#117272PurposeEncodes human DPP6 variant 1DepositorAvailable SinceOct. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAav-MCS-PQS2-3xHA
Plasmid#84917PurposerAAV-based template for genome engineering of protein C-termini containing PQS2 and 3xHA tags and a selection cassetteDepositorInsertLOX-PGK-NEO-LOX
UseAAVTagsPQS2 3xHAPromotermPGKAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-PGK-Puro-moxGFP
Plasmid#227275PurposeAAVS1 targeting donor for the insertion of Puro and a medium strength PGK expressing moxGFP. To be co-transfected with sgRNA plasmid px330-AAVS1 (Addgene #227272)DepositorInsertAAVS1 Homology Arms flanking a 2A-Puro-PGK-moxGFP cassette (AAVS1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAav-MCS-PQS1-3xFLAG
Plasmid#84883PurposerAAV-based template for genome engineering of protein C-termini containing PQS1 and 3xFLAG tags and a selection cassetteDepositorInsertMulticloning sites and selection cassette
UseAAVPromoterPGKAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
J23101-mRFP1-331Bb
Plasmid#78272PurposemRFP1 behind constitutive promoter J23101 in pSEVA331Bb backboneDepositorInsertJ23101-mRFP1
Available SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAav-IQGAP1-PQS1-3xFLAG
Plasmid#84885PurposerAAV-based template for genome engineering of the IQGAP1 C-terminus containing PQS1 and 3xFLAG tags and a selection cassetteDepositorInsertsUseAAVTagsPQS1 3xFLAGPromoternoAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAav-TP53-PQS1-3xFLAG
Plasmid#84884PurposerAAV-based template for genome engineering of the p53 C-terminus containing PQS1 and 3xFLAG tags and a selection cassetteDepositorInsertsUseAAVTagsPQS1 3xFLAGPromoterno and noAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAav-MDM2-PQS2-3xHA
Plasmid#84886PurposerAAV-based template for genome engineering of the MDM2 protein C-terminus containing PQS2 and 3xHA tags and a selection cassetteDepositorUseAAVTagsPQS2 3xHAPromoternoAvailable SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-ACE2-A2
Plasmid#188687PurposesgRNADepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-ACE2-A4
Plasmid#188688PurposesgRNADepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only