-
Plasmid#173130PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj3b (kcnj3b Zebrafish)
UsePcr cloning vectorTagsExpressionMutationPromoterNo promoter at 5 end; T7 promoter at 3 end.Available sinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj4
Plasmid#173131PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj4 (kcnj4 Zebrafish)
UsePcr cloning vectorTagsExpressionMutationPromoterNo promoter at 5 end; T7 promoter at 3 end.Available sinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj9
Plasmid#173135PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj9 (kcnj9 Zebrafish)
UsePcr cloning vectorTagsExpressionMutationPromoterNo promoter at 5 end; T7 promoter at 3 end.Available sinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-D-kcnj10a
Plasmid#173137PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj10a (kcnj10a Zebrafish)
UsePcr cloning vectorTagsExpressionMutationPromoterNo promoter at 5 end; T7 promoter at 3 end.Available sinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-D-kcnj10b
Plasmid#173138PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj10b (LOC100329607 Zebrafish)
UsePcr cloning vectorTagsExpressionMutationPromoterNo promoter at 5 end; T7 promoter at 3 end.Available sinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj11l
Plasmid#173140PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj11l (kcnj11l Zebrafish)
UsePcr cloning vectorTagsExpressionMutationPromoterNo promoter at 5 end; T7 promoter at 3 end.Available sinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP3
Plasmid#113974PurposeSingle short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sg1
Plasmid#113966PurposeSingle short guide RNA targeting GTATAGCATACATTATACGDepositorInsertsg1
UseTagsExpressionMutationPromoterU6Available sinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUS250
Plasmid#198322PurposeCumate-inducible gene expression in diverse gram negative bacteria. Features also include mobilisation via oriT, a gigantic multiple cloning site, and blue/white screening via amilCP chromoproteinDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionBacterialMutationPromotercumate-inducibleAvailable sinceApril 12, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTE-28S15-0X
Plasmid#20319DepositorInsertPsmyc-tetR#28
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 6, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMS26
Plasmid#32295DepositorTypeEmpty backboneUseBacterial gene additionTagsExpressionBacterialMutationPromoterrhaBAvailable sinceSept. 26, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTC-28S15-0X
Plasmid#20316DepositorInsertPsmyc-tetR#28
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
pTE-10M0X
Plasmid#20318DepositorInsertPimyc-tetR#10
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 6, 2009AvailabilityAcademic Institutions and Nonprofits only -
p(+)MV-NSE-FlagrP-3g_haP-F497A-3p
Plasmid#58799PurposeExpresses recombinant measles virus with duplicated P gene. wt P gene and P-F497A gene are tagged with Flag and HA peptides and si1 (siGFP) and si2 (siP) target sequences, respectively.DepositorInsertMeasles virus antigenome
UseTagsFlag and HaExpressionMutationPromoterT7Available sinceAug. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMG207
Plasmid#39273DepositorTypeEmpty backboneUseE coli gene targetingTagsExpressionMutationPromoterAvailable sinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
p(+)MV-NSE-FlagrP-3g_haP-F497D-3p
Plasmid#58800PurposeExpresses recombinant measles virus with duplicated P gene. wt P gene and P-F497D gene are tagged with Flag and HA peptides and si1 (siGFP) and si2 (siP) target sequences, respectively.DepositorInsertMeasles virus antigenome
UseTagsFlag and HaExpressionMutationPromoterT7Available sinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBAD-bARGSer-AxeTxe
Plasmid#192473PurposeSecond-generation bacterial acoustic reporter gene derived from SerratiaDepositorInsertsbARGSer
AxeTxe
UseTagsExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterNative promoter from Enterococcus faecium and pBADAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOTag2T-crelox-PUR
Plasmid#24026DepositorTypeEmpty backboneUseCre/LoxTagsExpressionMutationPromoterAvailable sinceFeb. 25, 2010AvailabilityAcademic Institutions and Nonprofits only