We narrowed to 11,686 results for: nts
-
Plasmid#48366PurposeGFP-intergenic region of TUB-HYG (modified from PMID 16269191)DepositorInsertGFP-intergenic region of TUB-HYG (modified from PMID 16269191)
UseCre/Lox; Knockout in t. bruceiAvailable SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDS67
Plasmid#48365Purpose3XMYC-intergenic region of TUB-HYG (modified from PMID 16269191)DepositorInsert3XMYC-intergenic region of TUB-HYG (modified from PMID 16269191)
UseCre/Lox; Knockout in t. bruceiAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
GLSA
Plasmid#42405PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
pEN243-EN1953
Plasmid#224546PurposeCas9-2A-puro and sgRNA targeting the first coding ATG of mouse NipblDepositorInsertCas9-2A-puro and sgRNA targeting the first coding ATG of mouse Nipbl (Nipbl Mouse)
ExpressionMammalianAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUW-TetO-CREB3L2
Plasmid#207207Purposedoxycycline-inducible expression of Human CREB3L2 in mammalian cellsDepositorInsertpFUW-TetO-CREB3L2
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUW-TetO-ZEB2
Plasmid#207203Purposedoxycycline-inducible expression of Human ZEB in mammalian cellsDepositorInsertpFUW-TetO-ZEB2
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUW-TetO-NFATC2
Plasmid#207191Purposedoxycycline-inducible expression of Human NFATC2 in mammalian cellsDepositorInsertpFUW-TetO-NFATC2
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-YAP-MAML2
Plasmid#237674PurposeFor overexpression of mEGFP-YAP-MAML2DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-N-mEGFP-PARP15
Plasmid#178000PurposeExpresses N-terminally mEGFP-tagged PARP15DepositorAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPmacroH2A.1-GS3
Plasmid#204759PurposeExpression of Cas9 and human macroH2A.1DepositorInsertmacroH2A1 (MACROH2A1 Human)
ExpressionMammalianAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPH2A.X_S139A-GS3
Plasmid#204749PurposeExpression of Cas9 and human H2AX with the S139A mutationDepositorAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-UBC-MCP-mNeonGreen
Plasmid#207581PurposeThe lentiviral plasmids for expression of MCP-NeonGreenDepositorInsertMS2 coat protein mNeonGreen fusion
UseLentiviralTagsmNeonGreenPromoterUBCAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
PET-Sniper SpCas9-NLS-6xHis
Plasmid#207374PurposeExpression of increased-fidelity (i.e. high-fidelity) SpCas9 variant in bacterial cellsDepositorInsertSniper SpCas9
UseCRISPRTags6xHisExpressionBacterialMutationF539S, M763I, K890NPromoterT7Available SinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pco-vCASphi_E9t_V2_CmYLCVp_35sT_ribozyme_AtPDS3_gRNA10
Plasmid#197966PurposeT-DNA binary vector to express pco-vCasphi driven by UBQ10 gene promoter, and the AtPDS3 guide RNA 10 driven by CmYLCVp, flanked by ribozymes.DepositorInsertspco-vCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterCmYLCVp and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pco-vCASphi_E9t_V2_pUB10_E9t_ribozyme_AtPDS3_gRNA10
Plasmid#197979PurposeT-DNA binary vector to express pco-vCasphi driven by UBQ10 gene promoter, and the AtPDS3 guide RNA 10 driven by UBQ10 gene promoter, flanked by ribozymes.DepositorInsertspco-vCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterpUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hPPP3CC-FLAG
Plasmid#179162PurposeExpression vector of human protein phosphatase 3, catalytic subunit, gamma isoform (PPP3CC) tagged with FLAG at C-terminus, CAG promoter, rabbit globin poly(A) signal.DepositorInsertprotein phosphatase 3, catalytic subunit, gamma isoform (PPP3CC Human)
TagsFLAGExpressionMammalianAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMP71-tCD19-llo-mc38tmg
Plasmid#174603Purposeexpresses the extracellular and transmembrane domain of murine CD19 with a C terminal fusion of the LLO190 and minigenes of 3 neoantigens from the MC38 tumor in genes ADGPK, DPAGT and Reps1DepositorInsertextracell transmem domains moCD19 wCterm fusion LLO190 and minigenes of 3neoantigens MC38tumor in genes ADGPK DPAGT Reps1
ExpressionMammalianAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMP71-mtGFP-llo-lama4-alg8
Plasmid#174605Purposeexpresses palmytoylated GFP with a C terminal fusion of the LLO190 and minigenes of 2 neoantigens from the T3 tumor in genes Alg8 and Lama4DepositorInsertpalmytoylGFP w/C-term fusion LLO190 and minigenes of 2 neoantigens from the T3 tumor in genes Alg8 Lama4
ExpressionMammalianAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only