We narrowed to 6,664 results for: mCherry
-
Plasmid#62325PurposesgRNA for mammalian cells with mCherry markerDepositorInsertsgRNA
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC102
Plasmid#62337PurposesgRNA for mammalian cells with mCherry markerDepositorInsertsgRNA
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pVBL0001
Plasmid#242429PurposeStable genomic integration of Opto-IRE1 (HsIRE1dLD-mCherry-CRY2clust) using the Flp-in system.DepositorInsertIRE1alpha (ERN1 Human)
UseTagsmCherry, CRY2clustExpressionMammalianMutationDeletion of the lumenal domainPromoterCMV, tet-inducibleAvailable sinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-(inactive)CNOT7(minusCNOT6interaction)-V5H6.MCh.Puro
Plasmid#209937PurposeIn mammalian cells expresses TP fused to an inactive CNOT7 that does not interact with CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsEnzymatically inactive CCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with CNOT6) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-(inactive)CNOT7(minusNOT1interaction)-V5H6.MCh.Puro
Plasmid#209939PurposeIn mammalian cells expresses TP fused to an inactive CNOT7 that does not interact with NOT1 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsEnzymatically inactive CCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with NOT1) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusCNOT6interaction)-V5H6.MCh.Puro
Plasmid#209940PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with CNOT6) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusCNOT6NOT1interaction)-V5H6.MCh.Puro
Plasmid#209941PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with CNOT6 or NOT1 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with NOT1 and CNOT6) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusNOT1interaction)-V5H6.MCh.Puro
Plasmid#209942PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with NOT1 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with NOT1) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-ITGB6
Plasmid#235244PurposeEncodes gRNA for human ITGB6DepositorInsertITGB6 (ITGB6 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 JDM16-GFPnb-mCh
Plasmid#235667PurposeExpresses designed inhibitor of Hsp70 tagged with a GFP nano body and mCherryDepositorInsertJDM16-GFPnb-mCh (Mch Synthetic)
UseTagsGFP nanobody and mCherryExpressionMammalianMutationPromoterCMVAvailable sinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSD068F
Plasmid#218137PurposeLentiviral vector expressing evolved degron SD36 fused to eGFP with mCherry control.DepositorInsertSD36-eGFP-IRES2-mCherry
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJune 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRB133.2
Plasmid#181950PurposeaTc-inducible expression of PhoP with C-terminal mNeonGreen fusion. Also contains mCherry under PhoP-controlled promoter PvirKDepositorInsertPhoP-Salmonella enterica subsp. enterica serovar Typhimurium (AX04_RS23485 PhoP-Salmonella enterica subsp. enterica serovar Typhimurium, Synthetic)
UseTagsmNeonGreenExpressionBacterialMutationPromoterPhoP-mNG-PLtetO-1; mCherry-PvirK; tetR-J23106Available sinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET24a-LaM4-2xTS
Plasmid#162779PurposeBacterial expression of a functionalized anti-mCherry (LaM4) nanobody fused to two tyrosine sulfation (TS) motifs. LaM4-2xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-mCherry nanobody fused to two TS sites, T7, HA, BAP and His6 epitope
UseTagsBAP, HA, His6, T7, and TS site from proCCKExpressionBacterialMutationPromoterT7Available sinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPtrcAvailable sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLBM0050
Plasmid#172820PurposeLevel 2 module containing mCHERRY-nYFP HSP21-cYFPDepositorInsert[35S-P19][35S-CTPSSU-mCHERRY-3XFLAGnYFP][35S-CTPSSU-mHSP21-cYFPX3HA][35S-SP_SV40-CFP]
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLBM0070
Plasmid#172822PurposeLevel 2 module containing mCHERRY-nYFP HSP21-cYFP OEP7-mTRQDepositorInsert[35S-P19][35S-CTPSSU-mCHERRY-3XFLAGnYFP][35S-CTPSSU-mHSP21-cYFPX3HA][OEP7_mTRQ]
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMIII-Neo-mChe
Plasmid#153423PurposeRetroviral (MSCV) expression of mCherry fluorescent proteinDepositorInsertmCherry
UseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGWKS17
Plasmid#139420PurposeFluoroescent marker for use in Cryptococcus neoformans. Contains a non-codon optimised mCherry marker.DepositorInsertmCherry
UseTagsExpressionYeastMutationPromoterTEF1Available sinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-hsg(G:H)
Plasmid#138259PurposeExpression of humanized mCherry-targeting sgRNAs to the left (G) and right (H) of iCas9 recognition sequences to be used in Traffic Light reporter systemDepositorInsertmCherry targeting sgRNAs G and H
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
LENC-shTAF12.364
Plasmid#105579Purposeretrovirally express TAF12 shRNA with Neo resistance and mCherry markerDepositorInsertTAF12 shRNA #364
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterMSCV-LTRAvailable sinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only